Detailed Information [104053]

Strain Information
DGRC Number 104053
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1618 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1618 / FM7c
Break points/Insertion Site 5A13
Map Viewer
Related Genes cv CG3160
Original Number 1618
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1618

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 151
General Information NP_lines
Embryonic Expression sg
Larval GFP late in all tr.
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19945_0807
Flanking Sequence
NTTCCNTCTTGGTGACANTNCCNCTTANTTTGTATACTTCGGTAAGCTTCGGCTATCGAC
GGGNACCANNTTATGTTATTTCATTTNTGCATAGGTNCTTATGTGCAAGTGTGTGGCGAT
CGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTC
AGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCANTCAAATCCATGAAGAGCA
TNCTTNNGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATC
GATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTT
ATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCTTATTTTTG
GNNNNNNNNNNNNNNNGNNNNACNTNNNNNNNATGCNGNCTNANNGNNNNAGGCNTNTNA
NNCTNCACTGAAGCCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnn

Library Name / Clone Name np / np58903_0309
Strand Plus
Insertion Point 5430366
Chromosome Band X
Flanking Sequence
ctttactncgcacttattgcaagcatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgCACCTATGTATCGAGCCGAATCGTGTTGTTGCTTTGCCTAG
TTGATCCTCTAGCTNGAGCNTNGGNNACTCGCNAATNATGAAAANTAAAACTTTANAAAT
GATTNCNCCTAANTAATATAANNAGTAAATTTAAACCCCNCGGACATNCTAANGGTTANN
AGANAANNANANCCCNNTGNCNATNTTAAANGGNAAANAANACNNAAATNTCTNTCTCTC
ACTNNCACTCNTNNNNANAGNAAACNAAANNNANNTNTNTNTCGCNCNGNGCCACANNAA
TGTNNNATNNAAATGNNCNTCTGTNTCGGGCCCNANANGGGANTNGCTCTNNCNNNTATA
TATCCAGCCCCNAACTGTTGGNGCTCTNNCTNTATNATACCCTANCNCNAGNNNNTNNNN
NCCCNNNNANTTTNTAAAATNNAANNTTNNAAACCCNNNNNCCTNNANTANNGNTNANGN
NAAANTTAAAACCNNNNNNCNTTNAANNNNNNNNNNANNANNNANNNNNNNNNNNNNTNN
AACNNNNNNNNANNNNNANNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann


CLOSE