Detailed Information [104064]

Strain Information
DGRC Number 104064
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP2020 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP2020 / FM7c
Break points/Insertion Site 5C6
Map Viewer
Related Genes Act5C pogo{}66
Original Number 2020
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2020

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 156
General Information NP_lines
Embryonic Expression pns subset, scattered cells, thoracic dorsal stripes, gut
Larval GFP gut
Larval X-gal wing pouch without margin, epi, gut
Adult GFP gut
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26625_0807
Flanking Sequence
ggggccagnnngtgtttngtttttttgnnnggactaacgngggggnaaaaancccnttnt
ttggnctnncggtaagactccggctatcgacgggnaccaccttntgttatttcatcatgC
CAAGAAACAGAAGCAAAAGCAGCGGCACAAgatcgaagaatacataagagagaaccgtcg
ccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtca
tcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaatt
gtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttg
ttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggc
atatcagtctccactgaagccatcttntttntggnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np61163_0309
Strand Plus
Insertion Point 5632417
Chromosome Band X
Flanking Sequence
tttnctgcgcacttattgcaagtnatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgGTTTCTTGCTTTGCTTCTATTATATGTTTGCTTTCTTTACT
CCTCGCGTTTCCATTCTCTTTCCAAACGGCAATTTCAAACGTAACTGTCAACAATGGGCG
GACTGTTCTTGGACTTTTTTAATCATCATTAACCCCCCTTATTATACACTCAAAAAAAAA
ACAAGTTTNGCTCAATTNACCCAGATCCTNNATNAAAAGGGTAANCATGNTACTGGANTN
TTNAAAGGCAACCAANNGAATTGATNTAAANCTTCTATCTTACATNGGATTTTTTNGGCG
AGGGTNCTATCTTGCTACTTTGTNGANAGGCAGGGGCTNGGGCTTTTCAAGCGANCCTNT
ANCNGAGGGCTTNGGGNNNGNGCANTNCAACCNANCCNNANNCTNAAGNNTNNGNNNNNN
NNNNNNNNNNNNNANNNNANNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncn

Image Files
Disc

d1 (->Large)


CLOSE