Detailed Information [104070]

Strain Information
DGRC Number 104070
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2048 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2048 / CyO
Break points/Insertion Site 60A3
Map Viewer
Related Genes ytr gbb
Original Number 2048
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2048

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 936
General Information NP_lines
Embryonic Expression muscle subset?
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14055_0727
Strand Plus
Insertion Point 18894669
Chromosome Band 2R
Flanking Sequence
ttncgtgcactgnatttantgtatacttcggtaagcttcggctatcgacgggaccacctt
atgttatttcatcatgGGCAAAACATGGCCACCTATCGGATATCGATTGATGGTCGATTT
TATCTTCGATAAAAATGTATCCTATGTATATCGCATACCGAATGTTTAAATCgatcgaag
aatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaa
gggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccct
gggcataaaatccaacggaattgtggagttatcattgatgagctgccgagtcaatcgata
cagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattc
tatgctgtctcaaatgttagaggcatatcagtctccactnagctnttantattngngggn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE