Detailed Information [104125]

Strain Information
DGRC Number 104125
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2210 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2210 / CyO
Break points/Insertion Site 59D9
Map Viewer
Related Genes eIF2B-delta CG30414 CG30415
Original Number 2210
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2210

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 925
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal cns, fb
Adult GFP abdomen
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23555_0807
Strand Plus
Insertion Point 18429966
Chromosome Band 2R
Flanking Sequence
ANNCTNGTNGGGGAAAAAACCCANTTTTTTGGGNCCNNCGGGAAAAGCCTTCGGGCTTTT
CGACGGGGNACCACCCTTTTTNTTTATTTTCATCATGCCCGCGGGCGAATCAAGACGGGT
TATCGATTCACTTACATCGCTATCAACTGGGTGGGACGTTTTTTTGCCCATCGTGGAGCA
AAACTTTCGAGTNACTTTTCCCCGAATAATAATATAGAAATCGTAAGGGTAAAAGACAGN
AAGCACACTNNTTTAGGTGCTATAAGCCAGCATTCGTGCTTACCCATAGACGCAGGATTC
AGCTGGGATCGAAGAATCCATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTGGGGG
TCCGTTTTCAGGAAGGGCAAGCCATCCGNCATGTCATCCTNTTCAGACCAATCAAATCCA
TGAANAGCATCCCTGGGCATAAAATCCAACGGAATTGNGGNGTTATCATGATGAGCTGCC
GAGTCAATCGATACAGNCAACTGCCTTTGACCTTGGTTACTACTCTCTTCCGATGATGAT
GNCGCACTTATTCTNTGCTTGTCTCAATGCTAGAGGCATATTAGGTCTCCACTGGAAGCC
AATNNTATTNGNGNNTNCTNCGGTNCTCTNGCGGCCGNGCCCNNNNNNGTNNNGNNNGGG
TTANNTGGTGCNANNNTCCTTTTGCCCGTTNNTNGNTNAGGGNNTGGNGNGGNNGNNNTN
GCGGGGGGCNTTNGCNGTGNNNCGTNNNNNTNTCGTNCCGTGNGNTGGCGNNTNNGNNCG
NCGTGTGTTNGGTTCGNNCTtagcnngngctcgncgcntnntganagnnnntaanggtcc
antganctggtgcatccggnagcgtcgtnagatntncngaggcctgtgtnttntnncgng
ntanncctagngcggttccantngtnncaccngtgttnngcgcgngngnnnnagntattt
ngcatnngttnngtttcgcgtgttttcnancanttttttganacnctttancnggnngtn
atnagcccnncntgtagncctcncttngttnntcntacacngtngantnaagnagaaatg

Library Name / Clone Name np / np27875_0807
Strand Plus
Insertion Point 18430070
Chromosome Band 2R
Flanking Sequence
cttttttggggnaaaaaccccaattttatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCCGCGGCGAATCAAGACGGTTATCGATTCACTTACATCG
CTATCAACTGGTGGACGTTTTTTTGCCATCGTGAGCAAAACTTTCGAGTTACTTTTCCCG
AATAATAATATAGAATCGTAAGGTAAAGACAGCAAGCACACTGCTTAGGTGCTATAAGCC
AGCATTCGTGCTTACCCATAGACGCAGGATTCAGCTTGgatcgaagaatacataagagag
aaccgtcgccaaagaacccattattgntggggtccgttttcaggaagggcaagccatccg
acatgtcatcctttttagaccaatcnaatccatgaagagcattcctgggcataaaatcca
acggaattgnggaggttatcaagatgagcctgccgggcnattcgatacagncnactggct
ttgacccttgttactacnctntancgnagangatggcccacttatttntntgctngcttn
aatgntagaggcnnnttcaagntnccctggagccatnttttttgngnnnnnntntnnntn
tnnntgntnnttntttnntttnnnnntnttntttnnnntctntntntgnnnnntttntat
tttcntngttcttcnnnnncnnnnnnccnnnttnctngnnnnnnttnnnttnnncnnnnn
cttcnntnttnnnngttnnntttnnnncgnnnncttttnnnntcttnnnnncttntccnc
ntnnnnnnnnnnnnntnncctnnntttntnnttnnnccctccgnnnntnctnnnnttttt
tttnnnnnnnnnnnnttttccnttnntnncncntcttntnnnnnntnnntnnnttnnttn
nnttnnnttncttnncncnnnannntttnnnncncnnnncncccccncnncccaaaaaaa
ncnncnncccnn

Image Files
Disc

d1 (->Large)


CLOSE