Detailed Information [104130]

Strain Information
DGRC Number 104130
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2227 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2227 / TM3, Sb1 Ser1
Break points/Insertion Site 65E7
Map Viewer
Related Genes melt Dbi
Original Number 2227
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2227

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1801
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22065_0807
Strand Minus
Insertion Point 7093941
Chromosome Band 3L
Flanking Sequence
ggggggnaangnntngtttnnntttnttgggnnngantcacacggttgtgaaaaancccc
catttntttngggactnncggaaaagaccncggctattcgacgggnaccaccttatgtta
tttcatcatgCTCTGGGACTCTCTCTCANCACCTCTCGCTACCGNANTANGCAGAACAGG
TGTNTCGGNCGTCAAGGCAACTGTGATTCNTTAACTCAACATTCTATATCGAAAACTNGN
AGAGGNCGGAATGCTTCTTGAGCGCCTAAAAGTGTGCAGTGAAATCATGTTAATNCANTN
GGCGGNGGCAAAACAGGAATCACACATATGANGTGATNAAAAATNATANAAGGTTTGACA
CCTNNAAATAATAAGAAAACAAAAATNCGGAAACTGTGATAANNGATTNAATTGAAANCT
TAATNCAATGGCCCTACAAATCTGTTGAATATCCGTTGAATACACTTTTCCAGGGTGTGT
CCTAGTCGGCTCCTCTTTGTTACCCCAGTTTGCTGGTCTTCTTAGCCGCACACCAGTTTA
TCGCTGTTTTGCCTTTGCGCTTTTCATTCATAAACAAAAAACAATGTTATTGTTATTGCG
GTGGCTGTAGATGTAAATGTAAATGTAGATGTAGAGGCTGCTTCTTGNGTCTGCTTCCTT
TTCTTTGCTGNTGCGATGTTGCTGATTCACCTGTTGCGCACGATTTAGCAACTGGCCACT
AGCAACATGTTGCTATCGGCAGATGATGTTGCGATTGCATTTAAACAAACCCAACTTAAT
TCGGGAAAAATCGGGGCCAAttatctaaagctttcgntaagntaaactacgtacgtnaaa
caggatagatggatggctcaaggncnaagttttaggaaatnttcccctcgactttgaacc
cggtcgaagggggggtnggacaaacncnctcgagntngagatccntagaggnaccgcncc
aanaaccattntggnggggccnnttnaggaaggnagcctccgaaggtatccnttaaacan


CLOSE