Detailed Information [104141]

Strain Information
DGRC Number 104141
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG5641[NP2255] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}CG5641NP2255 / TM3, Sb1 Ser1
Break points/Insertion Site 87B10
Map Viewer
Related Genes Neu5Ac CG5245 CG5641
Original Number 2255
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2255

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1456
General Information NP_lines
Embryonic Expression muscle subset, pns subset
Larval GFP sg
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22265_0807
Strand Minus
Insertion Point 8254894
Chromosome Band 3R
Flanking Sequence
tttttnaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgCGTCCGCCGTTCAAAAAGACATTCGTGCCGCGCCACCC
CTTCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtc
cgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatg
aagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccga
gtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgt
cgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatntttt
ttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE