Detailed Information [104168]

Strain Information
DGRC Number 104168
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Phax[NP2354] / CyO
Genotype w*; P{w+mW.hs=GawB}PhaxNP2354 / CyO
Break points/Insertion Site 45A8
Map Viewer
Related Genes Su(var)2-10 CG8069 Mys45A
Original Number 2354
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2354

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 617
General Information NP_lines
Embryonic Expression muscle subset
Larval X-gal sg, cns
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21145_0807
Strand Minus
Insertion Point 4175056
Chromosome Band 2R
Flanking Sequence
tttttggcgtgcactgcaatttaantgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGTGCAGCTGTTTGTGCAACACTGAGCGGCAGAGTGACC
ATACTTACTGAGGATTACTTGGTGCATAGTTAAATTATTATGTTTATATTATTGGTCTTT
AATAGTGCAAAGATGTAGATAAGATTAGCTCGTGTTATATTTACAATAATAAAAAgatcg
aagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcag
gaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatc
cctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcga
tacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttat
tctatgctgtctcaatgttagaggcatatcagtctccactgagcatnttttttttnnggg
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE