Strain Information | |
---|---|
DGRC Number | 104168 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}Phax[NP2354] / CyO |
Genotype | w*; P{w+mW.hs=GawB}PhaxNP2354 / CyO |
Break points/Insertion Site | 45A8 |
Map Viewer | ![]() |
Related Genes | Su(var)2-10 CG8069 Mys45A |
Original Number | 2354 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP2354 NP line. Received from the National Institute of Genetics. |
Balancer | CyO |
Cluster id | 617 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | muscle subset |
Larval X-gal | sg, cns |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np21145_0807 |
Strand | Minus |
Insertion Point | 4175056 |
Chromosome Band | 2R |
Flanking Sequence | tttttggcgtgcactgcaatttaantgtatacttcggtaagcttcggctatcgacgggac caccttatgttatttcatcatgGTGCAGCTGTTTGTGCAACACTGAGCGGCAGAGTGACC ATACTTACTGAGGATTACTTGGTGCATAGTTAAATTATTATGTTTATATTATTGGTCTTT AATAGTGCAAAGATGTAGATAAGATTAGCTCGTGTTATATTTACAATAATAAAAAgatcg aagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcag gaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatc cctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcga tacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttat tctatgctgtctcaatgttagaggcatatcagtctccactgagcatnttttttttnnggg nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
Image Files | ||
---|---|---|
Disc |
|