Detailed Information [104173]

Strain Information
DGRC Number 104173
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2364 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2364 / CyO
Break points/Insertion Site 40A6
Map Viewer
Related Genes CG11629 tsh
Original Number 2364
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2364

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1304
General Information NP_lines
Lethality lethal
Embryonic Expression epi (trunk region only)
Larval GFP fb
Larval X-gal two regions in dorsal and ventral wing disc
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21235_0807
Strand Minus
Insertion Point 21680044
Chromosome Band 2L
Flanking Sequence
anttntttnggtgcactgnatttanttgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGTTCTGTCCATCAAGAAGAGCAAAAAGAAGATGAAGA
AGAAGCAGAAGATGCTGCCCGGCAGCAACAACAAAATGCCGTACACTTGAGATAATGCTG
CTGTTTTGGATAGTTTCTTTTATTATTGCTCCCTCTGTCTCCGATGCATTTGTTGCTGTT
GCTGCAGCTTTCCGCATTGTTGTATTTTCTATTAATGTTGTTGCTATTGCTATTCTGCTT
CGTTCACGCTATTGTTGTTGCTATAAGTAATGTTCCTTTTTCCTAACTGTGGTGCACGAA
AAGAAAAGTCTTATGAAATCAAAATATGTATGTATGTATGTATTTCTGNGCCGAATTATA
TCATTTGTACGTTGTTCACGTGGGCCACTTTACCATAGAATGAGAGATCGAAANATNCAT
AAGANANAACCGNNGNCAAAGAACCCATTATTGGTGGGGTTCCGTTTCAAGAAAGGCAAG
CCATCCNACATGTTATGCTTCTTAAANCAATCAAATNCATGNAGAGCATTCCTNGGCATA
AAAATCAACNGAAATGGGGGGNTATNATGAAGAGCTGGCCAGGCAATCGATACAAGNAAC
TGGCTTTGANCCTTGGTACCACCTTNTTTCGAAGATGANGNCCCNCTTATCTNTGCTGGC
CCAANGGTAGAGNATATNAGGCTCNTNGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCNNTNNNnnnncnnnnnnnnnnnnnnnnnnnnnnnnttttnnnnnnn
cnnnnnnnnnnggnnnnnnnnnnnncnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE