Detailed Information [104178]

Strain Information
DGRC Number 104178
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Mvl[NP2375] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}MvlNP2375 / TM3, Sb1 Ser1
Break points/Insertion Site 93B8
Map Viewer
Related Genes Cortactin Mvl
Original Number 2375
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2375

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1568
General Information NP_lines
Embryonic Expression AS, epi stripe
Larval GFP gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21315_0807
Flanking Sequence
TTTNANTTGNATCCTTTCGGGTAAGGCTTTCGGGCTATCGACGGGGACCACCCTTTATGT
TATTTTCATCATGGGTACTAACCTTATCGGGCCAAACTGAAGTTTTAAACTCTGAGCCCA
CGCGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGNTGGGGTCC
GTTTTCAGGAAGGGCAAGCCATNCGACATGTCATNCTTTTCAGANCAATCAAATNCATGA
AGAGCATNCCTGGGCATAAAATCCAACGGAATTGNGGAGTTATNATGATGAGCTGNCGAG
TCAATCGATACAGNCAACTGNCTTTGACCTTTGGTACTACTCTNTTTCGANGATGATGNC
GCACTTATTCTATGCTGGCTCAATGNTAGAGGNATATNAGTCTCCACTGGAGCATCTTNT
TTTTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCNNNNNNNCNNNNT
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnan

Library Name / Clone Name np / np59373_0309
Strand Minus
Insertion Point 16886483
Chromosome Band 3R
Flanking Sequence
aaactgtctgngnactaacaccgcaagtnattangttaagtggaatgtctcttgccgacg
ggnaccaccttatgttatttcatcatgGCTCGNACNNTNGCCGAGGGTTGCCAGANTTCN
GCAAGGCAAAGAAGAGAGAGTGGCCGCAGGTTGCCACATTGGGCACAGACGAAAAGACAG
TGTGCATGTGAGAGGCGAGTGAGTGTGCGTGCAAAAGAAAGCAGCTGNTNTTTTTAATCN
CAAAGATTGNGAGGAAAANGAATAAACAAAGAGCTGCGCTCACGGCTGAGCACAAANTGC
CTGCACGCTCGTCAATAGNCGNGAACTAAGTCAGNAATTGGNAGCCAAACCGACCGNTTN
TTCGNNATTTCTNTGNTTNGTTNACTGNGACCATTACCACTANTGTTTNGGCCGTACAAC
GNCANGGAATTNGTAAANTTNGTAAANTGNTNNGNNAGAAAAGNAGGAAAATGCATTTAT
AAGCTGNCACAAGNGNNNAGATTGNGATATAANAAANGNAGGGTTNNNNANAGNNNNNNC
NNNNNNNGNNNNNNNNCCNTNNNCNNNNNNNANGAAAGANAANNNNNNAGNNNNNNNAAN
NACAACTTCCNAANTNNAATNNNNNTNTTNNNNNTTTTTTCNCNTTTTNNACGNTTATTN
ACANANANCCNNNGNNTNATTNNNNNNNTTTTTTTNNGTNNTTNNNNNAANNTTNNNNNN
CNANNNANTTNNTANNNNNNAAACANTCTNNTTTNTAGTTAANNTNNNAANANAATGNTN
ACCGNTTNTTCGAATTNATNanannnnntnaanannnaantnncaaccnannnnatnant
atnttttntcgtngnnnnnantttttnntnngtgnnaantnanagnnannnannangnnt
ccnnnaaaanntnnatngngtntngtnggtnanntntgnggngcctncntcnancnnacn
cccccncccg

Image Files
Disc

d1 (->Large)


CLOSE