Detailed Information [104184]

Strain Information
DGRC Number 104184
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP2388 / FM7c
Genotype w* P{w+mW.hs=GawB}NP2388 / FM7c
Break points/Insertion Site 13F1
Map Viewer
Related Genes CG8509 PGRP-LE
Original Number 2388
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2388

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 371
General Information NP_lines
Embryonic Expression scattered cells
Larval GFP sg
Larval X-gal wing margin and pouch
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21405_0807
Strand Minus
Insertion Point 15536163
Chromosome Band X
Flanking Sequence
actactgtngggnaaaaaacccccccttttttgggggcnnncgnaaagnccccggctatt
cgacgggaccaccttatgttatttcatcatgGGATAGGGATACTATCCAATCCAACACTA
TCCAATCCCAATCCACTCCACGCTCTCTATATGTAAACTTAGCACACACGAACGCAAATT
TACACTGGCATACATGAAATGCAATTATTATTATTATTATTATTATTATTTTTTTTTTGN
TCCCACGGNCNGTTTCAGATNGAANAATNCATAAGANAGAACCGCNGCCAAANAACCCAT
TATGGNGGGGGTCCGTTTTCAGGAGGGGCAAGCCATCCGACANGTCATCCTCTTCAGACC
AATCAAATCCANGANGAGCATCCCNGGGCATAAAATCCANCGGAATGGNGGAGTNATCAN
GATGAGCNGCCGAGTCAATCGATACAGCCAACGGGCTTTGACCTTGGNTACTACTCTCTT
CCGAGGANGANGGCNCACTNATTNTATGCTGGCTNAANGGNGGAGGCATATCAGCCTCCA
CNGAAGCCATNTTANTNNGGNNNNNNNNNNNNCNNNNNNNGNGGNNNNNNNNNNNNNNNN
GGNNNNNNTGNGNNNGGNGNNNNGAGGGNNNNNGGNNNNNNNGNGNGNGNGNNGNGNGGG
NGNGCNNGNGGGGNNGNTNNNNGNNCNNNNNNNCNNNNNTNTNNNNCNNNNNNNNNGNNN
NNGNGNNNGNNNNNNNNNNNCNNCGNTNNNNNNGNNNNNCNNNNNNNNNNNGGNCGNNNN
NNNNGNNNNNNCGNTNTNNNnggnnnnnnnnnnngnnagntcgnggnnngnnggnnntng
cnntngnnnngnnnntgnngnnnnnncnnnnnnngnnnngnntgtnnnnnnnggngnnnn
gnngnnnngnnggnnnnnnngnnnngtnngngngnngggnnntgnggnnngnngnnnnnn
nnnnngttnncngnnnnnnnncgcntnnanngnnnnaaaaaan

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)


CLOSE