Detailed Information [104191]

Strain Information
DGRC Number 104191
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG5604[NP2404] / CyO
Genotype w*; P{w+mW.hs=GawB}CG5604NP2404 / CyO
Break points/Insertion Site 31C6
Map Viewer
Related Genes Hand CG5604 CG5640
Original Number 2404
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2404

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1146
General Information NP_lines
Embryonic Expression dorsal vessel (from st 13)
Larval GFP gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21515_0807
Strand Plus
Insertion Point 10283895
Chromosome Band 2L
Flanking Sequence
ACTNCTGTNGGGGAAAAAACCCCCCNTTTTTNGGGGCNNNNNAAAANCCCCCGGGCTATT
CGACGGGGACCACCTTTTNTTNTTTCATCATNACTCGAAGTTNGCCAAGTGATGTTATAA
TATATGTATGCACATATGTACGCTTGTACGTTCATATGCGAATTGTTTTCATACAAGATA
ACGGTAAGTGCTAAAAACTGTTTTGAAAATCAACAACATAAGCATATGTNCNTTTTTATG
TACCGATATACACATACACANATGCATGTATGTAATCACTTTTTCAATTACACTTGATAC
TTTTTCTTGCACATGATAATAACGATGGGTATCCCGTTTTACGTTTTAGCATTACACAAA
AGGTAATTNCATTTTTATGNGGAAAGAGAATTTAAAGAATCGTGTAAAGAATGATGACAC
TTTATGCTTTNCTCTCCTTNAACGAATTACCAGTGTGTGNNTGTATAATTTAAAGACCTT
TCTTTTCTGANAGCCCAACANTGGAGCAACATAAAAACGCAGGNGNGNTANCCATTTGTC
TTNGGCCAGGGGTGGGGCACTAGNNACAAAACANGNTGGNGGACCCACACGNAAAACATG
CGCACACGGGANGNAAGTCGNGCATTGTGGGATNAACCNAGGANGGNNAGGNCAGTGGNG
GNCACNCCNNCNNGNCTNTGGGGGGGGGNAANGGCGGGGGGNGNGNGGNGGNNGGGGCGG
CGCGGGCGNGNGGGGGGGGGGNNCGNGGGCGNCGGGGCCGNCTNNNNTNGNCCCNANCCN
NANACNNCANCCCAACCCCAanaccngnncnnnnccnncnncncnnnccnncncnggccc
ngacgcntcccncngnccnncngcnnnntnncncccnnnccggnnnnnngccnnncancn
nnncnnncnnncnnnccngnnnnngncgccnngnncgccncncggggngcncnncnggtc
nnncnngcncnnnnnacccnnaganggaaagccgnganaaaaaaaaaaaaaaag


CLOSE