Detailed Information [104193]

Strain Information
DGRC Number 104193
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2408 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2408 / TM3, Sb1 Ser1
Break points/Insertion Site 82D1; ---
Map Viewer
Related Genes rpk CG40265 CG40311 Dip2
Original Number 2408
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2408

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1321 2058
General Information NP_lines
Lethality lethal
Embryonic Expression scattered cells
Larval GFP tr
Larval X-gal tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np59443_0309
Strand Plus
Insertion Point 471347
Chromosome Band 3R
Flanking Sequence
ttttntcgggcncactaaccgnattttttggttaagtggatgtctcttgccgacgggnac
caccttatgttatttcatcatgGTACGAAGCATTCGTTATCGATACATATCGAGGCGTAA
CGAGGATTTGGATTTTCAACTCGTTTCCACTTTTCTGCGTTTTGAAATATTTTTCTTTGG
AGTTTTAATTTTTAACAACACAGGCGAATGTGCAAATAATGAATTGGGATAACGTGTTAA
CAATGACAATTAATAAAGTTGCAGCAAATATGTACCTGTTTTTCGTTTTTGTTAATTTCA
ACAAAATTTAATTTAATTCGGAAGTAAAATATATCGCTAAATTGTCACCATCCGAACGTT
TTTTTGCAAGTTCTCTCCAAGATCCTCTAGCTAGAGCTTTGGGTACTAGNGGATNATGGA
TAATATANNTAGAGCTNTGATTTTNNTTNATTTATATNANGAGNNNNTTTAAANTNNNNN
TTNTTGNTNTAGGNTTANAANAGATNTATNTNNTNNNTNNNTANANNNNTNTTNTNTNNN
ANNTTTNNNTTTTNNTNTTNNTNTTTTTTTNNNNNTTNTTTTNNNNTTNNATTATANTTT
TNTATNNTTTNNNTATNTTTTNTNNTNTNGNAANNNANATNNTATTNNNNNTTNTNTATT
TNTTANTATTTANNNATNNTTNNTTNANTTNANNNNTGNNNTNTTTTTTTTTATTNTTTA
NNTTTTNTNTGTGTNNNTTTTTNTANTTTGTTATNTTNNNNNTTNTTANATNNTTATTTT
TTTNTTTTTTNTTTNTATNNgtttntnttnngtnattnattttttantnantagngantn
nnttnttnttnttttttcntttcccccccccctnttncccccccccct

Library Name / Clone Name np / np21535_0807
Strand Minus
Insertion Point 330277
Chromosome Band U
Flanking Sequence
NNNTTTGNTCTTCGGNAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGCCCT
AGAATAACAAGATGCGTAACGGCCATACATTGGTTTGGCACTATGCAGCCACTTTTTTGG
TGACGGCCAAAATTACTCTCTTTCCGCTCACTCCCGCTGAGAGCGTAAGAAACCTAAAAA
TATAATTTACTTGTTTGTGTGAGTAAAAACAAGAGACGAGAACGCGTATATTTGNGCGTG
TTGNGCTAGAAGACGATTTTCGGGCCGAAATCAATTCTGATCGAAGAATACATAAGAGAG
AACCGNCGCCAAAGAACCCATTATTGGTGGGGNNCGGTTTCAGGAAGGGCAAGNCATTCG
ACATGGNATTCTTTTNAGACCAATCAAATTCNTGAAGAGCATTCCTNGGCATAAAATNCC
ACGGGATTGNGGGGGTNTNATGAAGAGCTGGCCNGGNAATCGNTACCGGCAACCNGGTTT
TGACCCTTGGACCCCCTCTTTNCGANGANGAGGGNNCCCCTTTNTTTTGCTGGCCAAAGN
GTGANGNCNTNAATCTCCNCTGAGCTTTNTTTTNTGGGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnna

Image Files
Disc

d1 (->Large)


CLOSE