| Strain Information | |
|---|---|
| DGRC Number | 104266 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP2631 / CyO |
| Genotype | w*; P{w+mW.hs=GawB}NP2631 / CyO |
| Break points/Insertion Site | 44A3 |
| Map Viewer |  |
| Related Genes | Optix FB{}773 |
| Original Number | 2631 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP2631 NP line. Received from the National Institute of Genetics. |
| Balancer | CyO |
| Cluster id | 585 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | semi lethal |
| Embryonic Expression | cns, anterior terminal |
| Larval GFP | head skelton |
| Larval X-gal | anteriorend of wing pouch, oscelli? |
| Adult GFP | pupal wing margin, mouth, eye |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Sato K, Ahsan MT, Ote M, Koganezawa M, Yamamoto D. Calmodulin-binding transcription factor shapes the male courtship song in Drosophila. PLoS Genet (2019) 15(7) e1008309 [PubMed ID = 31344027] [RRC reference] Suzuki T, Takayama R, Sato M. eyeless/Pax6 controls the production of glial cells in the visual center of Drosophila melanogaster. Dev Biol (2016) 409(2) 343-53 [PubMed ID = 26670857] [RRC reference] Suzuki T, Hasegawa E, Nakai Y, Kaido M, Takayama R, Sato M. Formation of Neuronal Circuits by Interactions between Neuronal Populations Derived from Different Origins in the Drosophila Visual Center. Cell Rep (2016) 15(3) 499-509 [PubMed ID = 27068458] [RRC reference] Bielopolski N, Amin H, Apostolopoulou AA, Rozenfeld E, Lerner H, Huetteroth W, Lin AC, Parnas M. Inhibitory muscarinic acetylcholine receptors enhance aversive olfactory learning in adult Drosophila. Elife (2019) 8 [PubMed ID = 31215865] [RRC reference] von Philipsborn AC, Jorchel S, Tirian L, Demir E, Morita T, Stern DL, Dickson BJ. Cellular and behavioral functions of fruitless isoforms in Drosophila courtship. Curr Biol (2014) 24(3) 242-51 [PubMed ID = 24440391] [RRC reference] Lin AC, Bygrave AM, de Calignon A, Lee T, Miesenbock G. Sparse, decorrelated odor coding in the mushroom body enhances learned odor discrimination. Nat Neurosci (2014) 17(4) 559-68 [PubMed ID = 24561998] [RRC reference] Coen P, Clemens J, Weinstein AJ, Pacheco DA, Deng Y, Murthy M. Dynamic sensory cues shape song structure in Drosophila. Nature (2014) 507(7491) 233-7 [PubMed ID = 24598544] [RRC reference] Wu Y, Ren Q, Li H, Guo A. The GABAergic anterior paired lateral neurons facilitate olfactory reversal learning in Drosophila. Learn Mem (2012) 19(10) 478-86 [PubMed ID = 22988290] [RRC reference] Ren Q, Li H, Wu Y, Ren J, Guo A. A GABAergic inhibitory neural circuit regulates visual reversal learning in Drosophila. J Neurosci (2012) 32(34) 11524-38 [PubMed ID = 22915099] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np23435_0807 |
| Strand | Plus |
| Insertion Point | 3090605 |
| Chromosome Band | 2R |
| Flanking Sequence | CNTNNNTTGTTACTTCGGTAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGC TACTGACAGCGCCACAATAAAAACTTTTGCTCGTGAATATTTTGCCCCATTCGACGGGGC ATAAATCAAAAGTTCCCTTTTGCCAAAATGAAAACGTGATTTTCTCCTTGGTCATATATA TGTGCATATAAATGGCGGATGAGAGGGCTGGAGGGTCGTCCTGGCCCAAGGGTNTGGCTT ACCGGGAGCGAAGAGTTGGGGCTTCANAAAGGGGGAAATGGCATGGGAAGGAAAAGGGCN AGANGAAGGANCCGCGGCNGANGTTGGCNGACCNNCTGGNGGNAAACATTTTGCTTCCCT TANTCCATNTNNTTCACTTACCGGGGNGNCNAATCCATGGAAAGGCGGTTCGAGAATTCC TTAGGNAGGACCCGCNGCCAAGNACCCAATNTTGGTGGGGNTCCGTTTCAAGGAAGGGCA GGCCTTCNNCNTTGTATTCCTTTTNAAACCATTCAATTCCTTGAGGNGCNTCCTTGGCCN TAAANTCCACCGGANTTGGGGNGTTTTNATGAGGGCCTGCCAGTNATTCGTTCCAGCCAC CTGNCTTGACCTTGGTACTACTTTNTTCCAAGATGATGNCCACTTATCTATGCTGNCTCA TGGTAGAGGCATATCAGTCTCCTNCTCCNTTTTTNNGNGGGNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
