Detailed Information [104268]

Strain Information
DGRC Number 104268
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2637 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2637 / TM3, Sb1 Ser1
Break points/Insertion Site 82D2
Map Viewer
Related Genes Nep2 tacc
Original Number 2637
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2637

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1325
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23455_0807
Flanking Sequence
TTCTTTGGGGTNAAANAAACCCCNTTTTTTTTGGGGNNNNNGGNAAANNCCCNCGGGNTT
TTNGGACGGGGACCCCCTTTTTTTTTTTTTATTCNTGGCCNGCANGAGGTTTCCCAGGTT
TAANGCCCACCNGGCGGGANGANGCTNNTCTTCTTTTTGGTTTTNNTAGGGCTTTGGCGN
AGGGACCCCCGGNGCTAAGTNGGTTTTCGTNNGTGGCCGGGTNANGTTNACNCAATNCCN
CCTTTGNTCGANTNTTCCNTAAAAAAGANCCGTNNCCAANGANCCNATTNTGGTGGGGGT
CCGTTTTNAGGANGGGCAGGCCATCCNACNTGTNATCNTTTTNANACCAATNAAATCCNT
GANGNGCNTCCCTGGNCNTAAAATCCAACGGANTTGGGGAGTNATCATGATGAGCTGCCG
AGTNANTCGATCCAGTCAACTGTCTTTGNCCTTNGTTNCTNCTCTCTTCCGATGANGATG
TCNCACTTATTCTNTGCTGTCTNAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCT
NTNTNNGGNNNNNNNNNCTNNNNNNGNNGANGNNNNNCTTNNNNNNNNNTNNNNNNNNNG
NNNNGGGGNNNNNNNNNNNNNCNNTGNNNCCNNNNTTNNNNGNNNNNCNTNNNNNNNNNN
NNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNTTTNNNNNNNNNN
NNNNNNNNGGGGNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNTNNNTNNNNNNNNNNNNN
NNNNGTNNNGNNNGGNNGNGnnngnnggnngngggngngngngnnnggnnnngnnggtgn
gnnnngnnnnnntnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnntnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnna

Library Name / Clone Name np / np60213_0309
Strand Plus
Insertion Point 557670
Chromosome Band 3R
Flanking Sequence
tttactncgcacttattgcaagncatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgCTCTGCGGCGAGGCATTCGCACACGATTCTTTTCGTTTGAA
ACAATGCACAGGTGTATTGCGTTCAAATTGAATCCATTTTGGGATACCAAAAACAACGGA
ATCCATTTAGGATATATTTCAGGAACCGATGGCTCTGGTAACACTGTAAAAAAAGAGAAC
GCTTTTGCATCGACTATCAGATGCCTGTTACTCTGTTAAACGGAGATGGAGTACACTTCG
CGTCACCAGGTTAGCGACCCTTGAATAAAAATCTTTGATGTGAGATGTTTGGAAATTTTC
TTCTATAAACAATTCTATAAATGAAAAGTTTGTATGGGATACAGTTTGTTGTTTATAGAT
TTTATTTAAGTAAAAAAGATAAACAATCCATAAATGGGTAAATCAAAATTGGGTCATCAG
GATAGCGCCCCCTACGATAATTTAAGTTTTTTCCATTCAATCAGAATATTTGTAAAGGAA
ATTAAGAATGAGTTGATCCTCTNGCTNGGCCATGGGCCACTAGTGGATCTGGATCCTCTA
GCTGNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE