Detailed Information [104274]

Strain Information
DGRC Number 104274
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Lmpt[NP2647] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}LmptNP2647 / TM3, Sb1 Ser1
Break points/Insertion Site 73D5
Map Viewer
Related Genes CG32170 Lmpt
Original Number 2647
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2647

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1943
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP mt
Larval X-gal sg, mt
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24525_0807
Strand Minus
Insertion Point 16839963
Chromosome Band 3L
Flanking Sequence
acacttgnngngcanngcncttatttttanacttcggtaagctccggctatcgacgggac
caccttattttatttcatcatgGTCAGGGGAGTGCTCCAAAAGGTGTGCGATAATGGCAC
CGCACAAGTGTGTGCTCTGCTGCATCCAAAGGGCTAGGGAGGGGGAGTGGGAGTGCGAGA
ACGGGGGCGCAAGAGAGCCGCAAGAACCGCTTATTAGCAATTNNTTNCGATGCTTTTTTA
TGGCCCTCTNGANTAGCACACACACACGTGCAAGGGTAGTGACAATGTGGTGGGAGTAGC
AACTCCAGCACTGAGAGAAACGCCATAATNGGNNAAATNGGAAGGTTNATGCAAAAAAAG
ATTNNGGNGGGNNACTNANAACCNGNANGNGNNANTGGNATTGNNTGAGNNGCNNGGAGC
CATTGGGNNTGGGNAGNACACTGTGGNNACAGGGGNGNNNGNGGNCANGNGNANCGCNGA
NCCTNAGNNTTNNCANGNNGCNCCAGNNGANNNNNCCAGGNNGNNNANNANCGCTNNANA
CGCGTACNNCNNCCCNCGGNNNCNCNNGCCNCCCTNCNCGACCNATTNTCATNCANANCN
CCCNGNNCNTCCNNTTCCNCCTCTCCGCCNNTNNNNNCNNNNCCCCTNCCNTNCANCNNN
NACCCCACNNCACCAATCCCACNCTCCNNNNNACCCCTTTGNCNTNCTNCCCNTTCTCNT
NNNACNNCCTCATCCCNCCGCNNACCNNNTTNCNNCCGACNCTCTCCNNCCACNGCNCCC
CGNCCCCANNAATNTCATTCcgtgntcnccccctntatccncttnananccntnctnnnc
nncnctnaactncancatcnnactccgntcnantccncnntnnnccancnnnnancnncc
nnccncntncnancncncnaacaatcnnncccccacnncnactnanacannnantttncn
caaagtntnncnnntcnnccnctcctcncctcncncccnntcattnctccncattactcn
tcnccnatntccnnncncacncgannccnnctnnctcacacnnatnanacnacngnnanc
gnannnnnnnttacaaaag


CLOSE