Detailed Information [104328]
 

Strain Information
DGRC Number 104328
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG7707[NP2802] / TM3, Sb[1] Ser[1]
w*; P{w+mW.hs=GawB}CG7707NP2802 / TM3, Sb1 Ser1
Break points/Insertion Site 74A2
Map Viewer
Related Genes CG6497 CG6512 CG7707
Original Number 2802
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2802

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1951
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Matsuo E, Seki H, Asai T, Morimoto T, Miyakawa H, Ito K, Kamikouchi A.
Organization of projection neurons and local neurons of the primary auditory center in the fruit fly Drosophila melanogaster.
J. Comp. Neurol. (2016) 524(6) 1099-164 [PubMed ID = 26762251] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14235_0727
Strand Minus
Insertion Point 17193101
Chromosome Band 3L
Flanking Sequence
gtttttttnnnnnantactnnggtcacnnaccctatttttatacttcggtaagctncggc
tatcgacgggaccaccttatgttatttcatcatgAGCTGGCCTTTGCCTCTCCAATGACA
CCGATGAATGTGTTGCTCAATTCGACCTCCACGTTCCAGTGCCAAATGGTCTTGCCGAAT
CCCAGGATTCTAAAATTTCGAAATTGCTGCAGAGATATGTGCACAGCTCACATNTNGGTA
GACTCAAGGAGCAAAGGATTTAACTCACTCGCAATAGGCCGAAAATTGCCATTGTGTAAT
GGAGGCGCTTAAGTTTCAGTCTCTCAGCACTGAATACGTTGAACGTTCGCTCATTGAGGA
ACAGGAAATGGGCAAGGAACTTGCCCAGATGGTCAGCTTCGTTATAAAAAACAGCCTCCT
TAGAGTGGAAGTGCAGCAGACTGATGGCTACGTCGGATTCACTGTCTTCGTCGGAAAAGT
AGCTAATTGTCGTGCGCAGGACCTGCGAAAGGCGGTTGgatcgaagaatacataagagag
aaccgtcgccaaagaacccattattgttgggggtccgttttcaggaagggcaagccatcc
gacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatcc
aacggaattggggagttatcatgatgagctggccgagtcaatcgatacagncaaactgnc
tttgacccttggtactactctcttncgatgatgatgtcgcacttattctatgctgtctca
atggtagaggcatatcagtctcactncnnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnn

Library Name / Clone Name np / np16045_0727
Strand Minus
Insertion Point 17193242
Chromosome Band 3L
Flanking Sequence
GNCGGNGCGCCCCCCGGGGGNNNGGGGGGTTNNNGTTTTNTTTTGGGNANNAAACGGGGN
GTGAAAAACCCCTTTNTTTGGGGGACTTNCGGAAAAGCCTTCGGCTATCGACGGGNACCA
CNTTGTGTTATTTCATCATGAGGCNGGCCTTTGCCTCTCCAATGACACCGATGAANGGGG
NGCTCAATTCGACCTCCACGTTCCAGTGCCAAATGGTCTTGCCGAATCCCAGGATTCTAA
AATTTCGAAATTGCTGCAGAGATATGTGCACAGCTCACAACTCGGTAGACTCAAGGGGNN
GGGGATTTAACTCACTCGCAATAGGCCGAAAATTGCCATTGNGTAATGGAGGCGCTTAAG
TTTCAGNCTCTCAGCACTGAATACGTTGAACGTTCGCTCATTGAGGAACAGGAAATGGGC
AAGGAACTTGCCCAGATGGNCAGCTTCGNTATAAAAAACAGCCTCCTTAGAGNGGAAGNG
CAGCAGACTGATGGCTACGNNGGATNCACTGNCTNCGNCGGAAAAGNAGCTAATNGNCGN
GCGCAGGACCTGCGAAAGGCGGNNGGANCGAANAANACATAAGAGAGAACCGNNNNCAAA
GAACCCANNANNGNNGGGGNNCGNNNNNAGGAAGGGCAAGCCANNCGACANGNNANNCNN
NNNAGACCAANNAAANNCANGAAGAGCNNNCNNGGNCNTAAAANNCAACGGNANNGNGGN
GNNNNNANGANGAGNNGNCNNGNNAANNNNNNCANNNAANNNGNNNNNGNCCNNNGNNNC
NACNNNNNNNNNNNGANGANgnnnnncnnnnnnnnnngnngnnnnanngnnngaggnnnn
nnnnnnnnnanngagcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE