Detailed Information [104346]
 

Strain Information
DGRC Number 104346
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3028
Genotype y* w*; P{w+mW.hs=GawB}NP3028
Break points/Insertion Site 56F7; -; 56F8
Map Viewer
Related Genes 18w opus{}861
Original Number 3028
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3028

NP line. Received from the National Institute of Genetics.

Original Comments comment2:56F6-F9
Cluster id 878
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression stg9: pair rule in P cells in even # ps. later in stripe in all seg. splits into dorsal, lateral and ventral cell clusters. likely to be expressed in leg primordia, but not inwing.
Larval GFP fb
Larval X-gal ring covering proximal tarsus and tibia and ventral half ring in coxa, ring in AII in antenna,
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34075_0907
Strand Plus
Insertion Point 15174762
Chromosome Band 2R
Flanking Sequence
ggtnttttnnnnggnnttttaacgtgcactgactttaantgtatacttncggtaagnctt
cggctatcgacgggaccaccttatgttatttcatcatgACCCATCCTAACCCCACGGAAT
TATTCCATTTCCTAGTGCTAATTGTGTGGACGGAAATCTGAGAGAGCGCAGCGTAGGGTT
AATGATTTCTGTTTCCCCCATTCCATGCCCATGTGTGTGTGCAACATTTCCCCTACTTTC
GGGGAGAGAGAGAGAGAGCTCCGCTCTCCCAAGCGTGTGTGTGAGCGACATATGCAGCAG
GCAGGAAATGCAGTGCTTGTGTGTGTGCGTGTATCAGCAGCAGAGCAGAGAGCGAAAGCA
GCGCAGCGACAGCGTGGCATGTGTGTGTGCTCGCTCGTGAGAGTGCATTGCACATGCACA
TGCACATGCACGCGTACCGTGTTGTCTGTCTGCCGCGGCGCCGGCTGTGTGTGTGTGAGC
TCTGCCAGCTCGGCAGCGCCGTCGTCGGTTTCACATTTTCAACGAGCCAACGGAGTCGAG
ATGGCCAACTCCAGCAATCAGTTTGAATCGAAACGCGAGGCGGTAAACATGTTTTGAGAA
AACGAGCTCTCGCCGAACGAAACGAAGTCGAACACCCTGAGTCGCGCCAAGTGCCAAGTT
AAAATTATTATTATAAAATACGCAAGTTACCAACTTATGAGTTGNGTTGAGAGAANTCAC
AAAGAAACGAAACGAAAGTGAAAAATCGCAAAACGCAAAGCCAGCTCACACCAGGATTAC
AGAGCACTCGGGCTGCGAAAaaggcgatcgaanaaaacataananaaaaccgtngncaaa
naacccattattggnggggncccgttttcngggaagggcangccctnccaaatgttattc
tttt

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)

d5 (->Large)

CLOSE