Detailed Information [104359]

Strain Information
DGRC Number 104359
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}dve[NP3060]
Genotype y* w*; P{w+mW.hs=GawB}dveNP3060
Break points/Insertion Site 58D2
Map Viewer
Related Genes CG3380 dve CG5819
Original Number 3060
Chromosome 2
Comments Balanced by Cy chromosome 18Dec2012MT
FlyBase Insertion: P{GawB}NP3060

NP line. Received from the National Institute of Genetics.

Cluster id 911
General Information NP_lines
Lethality lethal
Embryonic Expression a small # of cells (TU)
Larval GFP wing pouch (excluded in margin), midgut.
Larval X-gal wing pouch,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H.
Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development.
Mech. Dev. (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14245_0727
Strand Plus
Insertion Point 17287614
Chromosome Band 2R
Flanking Sequence
antacttngngtcactnaacctattttatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTCAGTCAGGAGCAGGAGCCCAAGGATTCGGCACGCCAT
CTGCCGGAGAAACCAGACAGGCGGACAGCCAGACAGCCTGAACGCCTCAACCTCAACGGT
TGGCTTGATTTGCGATTGCCGCATTCGCCAAATTCGATACNCTGCCAATCCTGGTGACGC
AGTGACGCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgg
ggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatc
catgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctg
ccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatg
atgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatn
ttttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE