Detailed Information [104377]
 

Strain Information
DGRC Number 104377
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3106
Genotype w*; P{w+mW.hs=GawB}NP3106
Break points/Insertion Site 70C10
Map Viewer
Related Genes 26-29kD-proteinase CG9040
Original Number 3106
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3106

NP line. Received from the National Institute of Genetics.

Cluster id 1898
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression fb
Larval GFP cns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34865_0907
Strand Minus
Insertion Point 13942431
Chromosome Band 3L
Flanking Sequence
gttttttttaanggnancacgtttnggaattnnacccctttttnggggncnncggnaagn
ccncggctattcgacgggaccaccttttgttatttcatcatgGTCTCAGCGATATAAAGT
CTCACCCTCTCTTCGGAACTTGAACCTACTCCAAGTTTTGCTGCATTGCGCCCGCTCTCC
AACCGGACCGATAGTCGGACAGCACGGGATCNAAGAATNCATAAGAGAGAACCNTTTTNT
AAGAACCCATTATTGTCGGGGTCCGTNTTCAGGAAGGGCANGCCATTCCGACATGTCATC
CTNTNCANACCAAGCAAATCCATGAAGAGCANCTCCTGGNCNTAAAANNCAACGGAATTG
CGGAGTTATCATGATGAGCTGNCCGAGNCAATCCNCTACAGTCNACTGTNTTTGACCTTT
GGTACTACTCTCTTTCCGATGATGATGTCTNACTCACTTCTATGCTGNCNCANTGTCGNG
AGGCATATCAACCNCTCCACTGAAGCCAATCTTNCCNCGCTTNTNTTGCTCCGNCATTTN
TCCGTNCTCNCTTTGTTTNCCCTCTNCCGNCGTNNNCGNTNNNCTTNTCCNCNGTGNTNN
CCCNGCGCCTNCCTTNNGTNCANANCTNNNNTNGNCNNTCCCANANCGTCGTNTTNGTCC
GTCNCCCGNNCNCACGAGGANNCCTTGAATTTNTTTTCCCTTTCTCNNNTCCNCCCCTTT
TTCTNCTTTTTACATNATACCCTNTCTTCTTCCNCCCGTNCTNTTNCCATCCCCTCATCA
NTCGACGTTCTTNNCGCCGCggcgnnngtgatggntgnnnanncgntacntctttngnac
ctttncnncncctcgcgcgtataacnnanccccgtgngtcgcncgtttccgtnngnanng
attnccacangnngttccaatactccgtatacnntgtccccngncnttggaaatatccna
ncctcnncctttncccacagcgnnntnttttccggngnccatnnnntcncctctntnncc
ctccattatcatngtccnntcggngtcccgccgntccgtcnntttncnttcgccgttgtg
tggtgttattnngttcagagtntntnnctctncgttcnnnngnttgntcnngngngnccn
naantaattaaacacaacacaanaaat

CLOSE