Detailed Information [104440]

Strain Information
DGRC Number 104440
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG18011[NP3286] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}CG18011NP3286 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 46F2
Map Viewer
Related Genes Or46b CG18011 KCNQ
Original Number 3286
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3286

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 649
General Information NP_lines
Embryonic Expression weak internal
Larval GFP sg
Larval X-gal ch
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np36375_0907
Strand Plus
Insertion Point 5202985
Chromosome Band 2R
Flanking Sequence
gcnctgaatttttgtgtatacttcggtaagcttcggctatcgacgggaccaccttatgtt
atttcatcatgACGCCTACAATTTGCTGACGGACAAAGATTAAGATGTCGGAAAACGCGA
AAAACAATAGCTGCCTGCATTGCAGCGTATTCAGTACGAAATACCAGTACCAGGAgatcg
aagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcag
gaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatc
cctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcga
tacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttat
tctatgctgtctcaatgttagaggcatatcagtctccactgaagccatctttttntggnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnan


CLOSE