Detailed Information [104466]

Strain Information
DGRC Number 104466
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NFAT[NP3346] / FM7c
Genotype y* w* P{w+mW.hs=GawB}NFATNP3346 / FM7c
Break points/Insertion Site 12A9
Map Viewer
Related Genes NFAT CG12176 CG2691
Original Number 3346
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3346

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 326
General Information NP_lines
Embryonic Expression ventral epidermis, useful driver (SG)
Larval GFP gut, fb
Larval X-gal mt
Adult GFP abd
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38125_0907
Strand Plus
Insertion Point 13372722
Chromosome Band X
Flanking Sequence
gnnnngggnggngggnnnnnnnntangggngnggngtngtttgnttnnactntgnngann
nnaaggnaggtnnanganacccgnaactgggggcggtaaanaaaccctatncgtacgggn
accaccttatgttttttcatcatgGNATTCGTTCTTTTCGCCCGGACCGGACACTTGAGA
GAGAGAGAATTCTCCGGCTCGGTTTCGGATTCGGGTTCGAGTCTGCGCTAAAGTTATATA
GCGCGCCCACCTTTTTCCGCCGCAGTCCATCGATCTCAGNGTAAGTGTTCGNATAGCCAC
TCGNACGCCGCTNGNGCTNTTCCGATTACGGGTCACGGNNNGCGGGNNACGGNCTTGCGT
TNCGCGACTTACGAACTACGGNCTACGGNTNACGGNTACAATTACGGNTACGAACTCGNG
CTAAAAATNCGCACTTTGAGCTACCCGCTTTTTTTTCTGGNGNGANGNGCTNAATNAACG
NNCGNTATTNGAAATGNNAAAACTGGGGCGCCCTTTTATTACCAGCCGAANAANAATGAC
CTGNNCGNGGANNCCNNNAAAAANANCNTNGGNNAANNACNNNNNNNAGNNNANGNNNNN
NNNNNNNNANNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNANNNNNNNNNCNNNNNGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnn

Image Files
Embryo

e1 (->Large)


CLOSE