Detailed Information [104496]

Strain Information
DGRC Number 104496
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}KCNQ[NP3423] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}KCNQNP3423 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 46F3
Map Viewer
Related Genes CG12214 CG18011 KCNQ
Original Number 3423
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3423

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 650
General Information NP_lines
Lethality lethal
Embryonic Expression sg
Larval GFP fb
Larval X-gal fb, gut, tr
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np16265_0727
Flanking Sequence
gttttttnnnnnnatctntnagcgtgcactgcnctttnantgtatacttncggtaagcct
tcggctatcgacgggnnccaccttatgttatttcatcatgNACATGAACCTATGCNCTGC
ATNNAAGTAANNCNTNNGACAGAACCCTCTCCAAAGAACCCATTNTNGNTGGGAGTCGCG
NNANCAGGAAGGGCATGCCNTGCTNNNTGGCATGCTNTNNANNCCAANNCAANNCCTNAA
GAGCATGCNNGGGCATAANATACCAACNGGAATTGTGGGAGTCATAATGATGAGCTGCCG
AGNCAANCNATACAGGNANCTGTCTNNGACCTTCGNTACTANTCTCTNCCGNTGATGANG
ANGGNCTTATNCTANGCTGTGCTCAATGTNNGAGGCATATCAGACTCCACTGAAGCATCT
NNNNGGGNGNNAAAAAANCCAACGGGAATTGNGGAGTTATCATGATGAGCTGCCGAGTCA
ATCGATACAGNCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCA
CTTATTCTATGCTGNCTCAATGTTAGAGGCATATCAGTCTCCACTGAGCATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnn

Library Name / Clone Name np / np57843_0309
Strand Plus
Insertion Point 5213245
Chromosome Band 2R
Flanking Sequence
ggggcccgnnngnnngtttttggnnngatccttgtngcatnaacgcagtttacgttagtg
gntgtctcttgccgacgggnaccccttatgttatttcatcatgGGNCTGACCACANTAAN
NTCGCAANNGANCTNTACAAAATAGAGGNGCCTTTCTACGCGCTTNTCACAAGTTNTAGC
TANGCAGCTCNNNAACAAGANNTTCTTTGGNTATAAACACCANTGCAAATAGCGTCTAGT
GTGNGANNGTNTNAGAGTGCAAGGNTNNGGGANTGAGTCNGTGNTTNATCAANNCTGTAC
NNAACTNGTAAGAACTTGAAGTTTTGNCATATACCCCCGNNNGATACTTGAGGTTCNTTN
AAAGGTGACNCCCCNCNANGGATCTCTCTATCNNGNGNTCTNGNGCACNTCTTGAATTAT
TAAAAATNTAACAACTATNAAATATTGATNTCTCTAANTNATTATTGTGAGANTAATGTN
AAACCCCCACGNCCCTGCGGGGGGGTTAAGGGACNATAATANNGNTGTNTCTCCTGANAC
NCTANNNNCCTNTAAAAANACTANNNCCTNNACTCNCNCTTANNNNCNGAAACCAAAAAG
GGGNTNTNTNTTGNCTTNGGNCNACCNNNNANATNNNATTTTGNNNNNNNNNNGNNNNNN
NNNNNNNNNNTNNNNNNNNNNNNNNNTNNNNNNNGGGNNNAANANNNNNNNNNNNNNNNN
NANNNNNNNNNNNNNNNNNTNNNNNCNCNNNCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnannnnnnnnnnnnannnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccnnnnnnnnnnngnn
nntnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnncn


CLOSE