Detailed Information [104503]

Strain Information
DGRC Number 104503
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Sra-1[NP3436]
Genotype w*; P{w+mW.hs=GawB}Sra-1NP3436
Break points/Insertion Site 88F1
Map Viewer
Related Genes Sra-1 FK506-bp1
Original Number 3436
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3436

NP line. Received from the National Institute of Genetics.

Cluster id 1498
General Information NP_lines
Embryonic Expression sg
Larval GFP fb, sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np28955_0807
Strand Plus
Insertion Point 11158932
Chromosome Band 3R
Flanking Sequence
cttcttgggngaaaaaacccctcatttttanncttcggtaanactccggctatcgacggg
accaccttatgttatttcatcatgCATATAAGCATAAGCACATCGTAGACGCCAACCGCC
AGCAAAAATGTGCTAATTATGGCCACGTGTCCACGCACCCAGGCGAATGGTAAAAGTCGT
GTTGTATTTGTGGCGAAAAAAATTTGTGTCGATTGGATTGGGGNTNTTTTTCTTGTTAGA
ATTTAACCATTTCGCGCTGCTGGAGCATGATAAGCAGCCCAGCATGACGGAGAAGATTAC
GCTAGCCGACGCGCTGTCCAACGTGGAGGTGTTGGACGAGCTATCCCTGCCGGACGAGCA
GCCCTGCATCGAGGCGCAGCCCTGCTCGATTATCTACAAGGCAAACTTCGATACGAATTT
CGAGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtc
cgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatg
aagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccga
gtcaatcgatacagtcaactgtctttgacctttggtactactctcttccgatgatgatgt
cgcacttattctatgctgtctcaatgttagaggcatatcagtctcactgagcatnntttt
ttttgggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE