Detailed Information [104530]

Strain Information
DGRC Number 104530
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3520 / TM6, Sb[1] Tb[1]
Genotype w*; P{w+mW.hs=GawB}NP3520 / TM6, Sb1 Tb1
Original Number 3520
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3520

NP line. Received from the National Institute of Genetics.

Balancer TM6 Sb Tb
General Information NP_lines
Lethality lethal
Embryonic Expression weak scattered
Larval GFP sg, gut
Larval X-gal fg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13165_0727
Flanking Sequence
anntttngngtgcactgnatttatttgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgTTTTTGCTCATGGCTTCAGTCTCTGACTAGCACGCTTG
GGGAACACACAGTGAGCGGAGCGTCCGCAGTCGCAGTAGCACTCGAAGTCCGCTTATCCG
CATCCGCAGCGTTTTCGAATTTTTCAGACCTACCATTCGATCNAAGAATACATAAGAGAG
AACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCG
ACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCA
ACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTT
GACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATG
TTAGAGGCATATCAGTCTCCACTGAAGCATNTTTTTTNNGGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnn


CLOSE