Detailed Information [104563]

Strain Information
DGRC Number 104563
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}His3.3B[NP4000] / FM7c
Genotype y* w* P{w+mW.hs=GawB}His3.3BNP4000 / FM7c
Break points/Insertion Site 8D6
Map Viewer
Related Genes His3.3B Ost48
Original Number 4000
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4000

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 234
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP asp, sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np28515_0807
Strand Plus
Insertion Point 8895252
Chromosome Band X
Flanking Sequence
cttgctttnnngtgacactgccnttttnnttgtatacttcggtaagcttcggctatcgac
gggaccaccttatgttatttcatcatgAGCGCACCTCACCATTACAACTAAAACAACAAT
GCAACCAACAGTCGTGCGAATACGAGACCTCTCACATCTTCGTGTATTTGTGTATGTATC
CACCAGCGAGAATGCGCCTGTGTGTGTGCGGTGAAAAATAGGGCTTCCGCTGGACGGCCG
GCGGAGCCCCAAAAACGGCAAAACATAAACTCAGGCGATTCACAACGAAAAAAAAATTTG
GAAAACAGNGCACACACGCNCATNTTTAGGGGGCCACAGGCNCGTGCGNTTTAAGAACCN
CNCNTTGGTTTTTTAGGTTTTAGCAATAAAAAAAACCCCCCGGTTAACCCGGAAAAAGGN
TTTTTTTCAAANTTGGCCNTTTAAAACNGGGAANAAAATTTGGGNGGGGNAAATTTNCAA
AGGTTTTTTTTNGGGGNAACNNAAAAACTAANAAGGACCCCGCCCNAAAACCCNTTTTTG
GGGGGCCCTTTTNAGNGGGGGGNNCCCCCCCNNGTTTTTTTTTTTNAANAAAAAAANNNG
GGGGGGCNCCGGGGGAAAAAAANNNGGGGGGGGGNTTTTNNNNGGGGGGGGGNAAAAAAA
AAAAAANNTTTTTTTTTTTTTTTTTTTTTTTNNGGGGGGGGGNNNNTTTTTTTTTNTNNN
NNGGGGNANANCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np11165_0727
Flanking Sequence
ccnatnttttgggggaaaaaaccctttttttgtatacttncggtaagccttcggctatcg
acgggaccaccttatgttatttcatcatgAGCGCACCTCACCATTACAACTAAAACAACA
ATGCAACCAACAGTCGTGCGAATACGAGACCTCTCACATCTTCGTGTATTTGTGTATGTA
TCCACCAGCGAGAATGCGCCTGTGTGTGTGCGGTGAAAAATAGGNTTTNGNTGGACGGCC
GGCGGAGCCCCAAAAACGGCAAAACATAAACTCAGGCGATTCACAACGAAAAAAAAATTT
GGAAAACAGTGCACACACGCACATATTCAGCGGCCACAAGCACGTGCGTTTTAAGAACCA
CACTTAGTATTATAAGTATTTAGCAATAAAAAAAAACTCACCGTTAAACACGGAATAAAG
TTATTCTTCACAATTTGTCACTTTCAACACGAGACGAACAAATTCGGACGAGAGAAATTT
TCACAATGATTTCGTTTTCGTTGGGATCGAAGAATTCNTAAGAGAGAACCCGNGCCAAGA
ACCCATTTTTGGNGGGGGCCGNTTTNAGGGAGGGGAAGCCATTCCGACATGGTNATNCTT
TTTANACCAATCAAANTCCNTGAAGAGCNTNCCTGGGCATAAAATNCAACGGAATTGGGG
NGNTTTTATGATGAGGCTGGCCGAGNNAATCNAANCAGNNACNGGNTTGGCCCTTGGNAC
TACCTCTTTTCCGANGAGAANGNCGCACTTATTCTATGCTGGCTNATGNTAGAGGCATAT
NAGNCTCCNGCANNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Larval GFP

g1 (->Large)


CLOSE