Detailed Information [104632]

Strain Information
DGRC Number 104632
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP4211 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP4211 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 95A7
Map Viewer
Related Genes CG10157 eIF-3p66 CG13822
Original Number 4211
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4211

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1609
General Information NP_lines
Embryonic Expression cns, sg
Larval GFP tr fusion cells, gut
Larval X-gal mt
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np12685_0727
Flanking Sequence
GTTTTTGGNNNGACNANCGGGGGAAAAAACCCCCCCTGGGGGNNAAAAAAACCCCCCCCN
CGACGGGACCACCTTNGTGANTNCATCATGATNCGGCCGCNCAACGCCAGCGAACGCTCG
ACACTGAAATAATNCCGGGACTTGNAATGCGCAGCGNTGNCACTGCGTTNCGNCAAATTC
GAAGCGGCCAGTGGCGTGGNTAGAAAATGCTCAAGGGGGGCTCAANTTTTTTTTAAGNNA
AAAAAAAAATAATTANGGGGANGGCAATAGGAGGGGGACTTTCCGCTGGGNNNNAANAAN
NGGGNNGNAANATACCCGCNNNGGAAAAAATNAANATAAATATATAGATAAAGGGGGGGA
CTAGCCAACCAATTCGACGCCCCNGCNGGCAACCAGCATTTNCCCCTTAACATTAANGCG
CCGACTACGGAAAACNNACGGAGCAGCGGGGGTTAAANCNTATTTTNAGACCACCAGACA
GCNGGNNCCNGAAAAGAAANCGGNATACAAAAAACANGACCGAAAAGCCGAAAGGGANAN
ACNAAACACAGGGAAAATNTTNATGGGCCCCAAGGGGAGGCAGCGAGGAAGCAAAACACC
CCCAGGGGGGAAAAANAANGGGGNAATGGGGNCCGGGAACATGGAAACAGGNAAAANTAC
CCCAGNNCATTACAAAAAAAGNNAACAAAANGGCGGGAACAAGGGGGCAGNNGGAGGNGN
ACCTTTTCAAAACCNGCCGCAGAAGGGCCTTCCNAGGGGGGCGAAAGGCNCCCCGGGCCG
GAGGGGCCGAAAAANCAAAAnanaaaaccgcccccaanaaacccaaaaaggggggggggc
cggnnncagggnagggcaagncacccgaaaggaaaccccntcaagaccnaanaaanccag
gnagggccccccngggcaaaaaacccacgggaangggggggnaaaaaggaangngccgcc
gggnaaacgaacaagnaancgggntggganccnggaac

Library Name / Clone Name np / np31345_0907
Strand Minus
Insertion Point 19495310
Chromosome Band 3R
Flanking Sequence
gngnggngggnnnngnncggggggnngnngngnnngttttttggnnnngaacacgggggg
gncaaaaacccnanttntggncnnncggnaagctccggctatcgacgggaccaccttatg
ttattncatcatgATNCGGCCGCTCAACGCCAGCGAACGCTCGACACTGAAATAATNCCG
GGACTNGNAATGCGCAGCGNNGNCACTGCGTNNCGNCAAATNCGAAGCGGCCAGNGGCGN
GGNTAGAAAATGCTCAAGGGGGGCTCAAAAATCATATAAGNNAAAAAAAAAANAATNANG
GGGGATGGCAANAGNAGGGGGACTTTNCGCTGGGNNNNAANAANNNNNCNGNAAAAAATC
CGCTTTGGAAAAAATNAATATAAATATATAGATAAAGGGGGGGACNAGCCAACCAATNCG
ACGCCCCNGCNGGCAACCAGCATTNNCCCCTTNACATTNANGCGCNGACTACGGAAAACT
NACNGAGCAGNGGGGNTTNAATCTNATTTTNAGACCACCAGACAGCNGGTNCNGAAAAGA
ANCNGGANACAAAAACANGACNGAAAGCNGANANGGANANACCANACACAAGGAAATTTT
TAAGGGCCCCAGGGAGGCAGCGAGGAAGCAAACACCCCAGGGGGGAAAAAAATGGGNAAN
GGGGCNGGGAACATGGAACAGGNAAATACCCAGGNCANNACAAAAAAGGNNACAAAATGG
NGNACAAGGGGGCAGNNGGAAGGNGAACCTTTANANAAACCGCCGAAGAAGGGGCNTCGA
AGGGGGGGNNAAGGCCCNCCgggccgangggccnaanaaancaaaaaannaacccgnnnc
naanaaccaaaanggggggggcccnnnncanggaaggnaagncnncccgnaaggganccc
ntnannaccaanaaaancccnggnaaggcccccggggcaaaaaaaaccaacgggaanggg
gggggaaaaaagaaggnggggcnggaaaaaannaaaaanaaaaangggnnnggacccngg
gacaaccccnncccgngaagagggnnnccnaancnaaggcnggncnaagggggnggcaaa
aaacccccgaccnan

Library Name / Clone Name np / np62473_0309
Flanking Sequence
actttggggggcacnnaccgcaantttangttaagtggatgtctcttgccgacgggcacc
accttatgttatttcatcatgGGCCGAATATTTCAAGATCCNCNNGCNGGNGCNTNGGNC
ACTNGNGGATNATGGAAACTANANCTAGAGNNATGAGTNCNCNTAANTAATAAAANGNGT
AANTTTAAACCCNACGGACATGCTAANGNTTAAGAGTCAATTNTNTNTCTNCGGNCNTGC
TANGGGTTAATNAACAANCATATCGCTGNCTTACTCNCACNCTNNTTGCNAGCCAACGTA
NAGTGGNTNTCNCTTGCNCTNAGNGCCANCTTACGTNAATTGANNATGGGCCGAATATTG
CANGANCCTNTGNCNTTACATTATGNTCCNAATATTTCAAGANCCGNTTNCCTTANCATT
GGCCNCTTCTAANCCCCGATANNCCTNNCTTTACGACCNTTNCCCCCNTCNNCNTTNTAC
NTACCTCATCNNNANCNCCCTNCCCCTTCNTACCNCCNTNTTNNNNAANNNTNNANTNTT
CANACGNTTNNNANNNGNNNCNNCNNACNTTNTATTNCANTCTCNNCATTNNANTTNATC
CTCCCCACNNTTNCNAANTNNACCNCCCCNTCGTTCNCNTNTANNTTTNTTTNNCCCNNA
NNCNTCNTACCGCTCNTTNTTAATTNNCCCNNCNTATTCNCTTNNNNTTTTNCNANCACC
CCCCCNATTCNNTTNTTTTNNNGNNCCCNCNCANTTNANTCTTTNNNTNCTATTTCCCCC
CCCNNNTTTTTNTTCCCCTCccccccntnccnttttncncccctccnaannnantcnaca
ccnntttnntntntccnnncntnanccacncccnnncgtnntcncntgcntgcgtttttt
tcnncncncnnnnccngntcttntncncnttcagnttncgnattntnnntattgcnnttn
cgcaacntcantntatnctncagcgtattnncnnagcggncgtgtgcnn

Library Name / Clone Name np / np70525_0810
Strand Minus
Insertion Point 19495310
Chromosome Band 3R
Flanking Sequence
gtcaacgtgcactgnanttantgtntacttncggtagcttcggctatcgacgggnaccac
cttatgttatttcatcatgATTCGGCCGCTCAACGCCAGCGAACGCTCGACACTGAAATA
ATTCCGGGACTTGTAATGCGCAGCGTTGTCACTGCGTTTCGTCAAATTCGAAGCGGCCAG
TGGCGTGGTTAGAAAATGCTCAAGGGGGGCTCAAAAATCATATAAGTTAAAAAAAAAATA
ATTATTTGTATTGCAATAGTAGGGNGACTTTTCGCTTGTTTTTTATAATTTTTCTGTAAT
ATATCCGCTTTTGAAAAAATTAATATAAATNTNTAGATAANGGGNGNGACTAGCCAACCA
ATTCGACGCCCCTGCTGTCAACCAGCATTTTCCCCTTTACATTTATGCNCTGACTACGGA
AAACTTACTGNGCAGNGGGGTTTTAATCTTATTTTTAGACCACCANACAGCTGTTTCTGA
TTAGAATCTGTATACAAAAACATGGACTGATAAGCTGATATGTNTATACTATACACATGT
AAATTTTTATTGGCCCCAAGTGAGTCAGCGAGTAAGCAAACACTCCAGTTGGTTATAATT
ATTGTTTATTGGTCTTGGAACATTGAAACAGTTAAATTACTCAGTACATTCATAAAAAGT
TTACAAAATTGCGGAACAAGNGGGCAGTTTGGATGTTGAACTTTTTCAGATACTGCCGCC
AGAAATGTCTTTTCGAAGTTGTTGCGAATGCTTNTNTGGGNCGTAAGGGTCCAANAATCC
ATANNAAANACCGTNGCCAAanaacccnttttgttggggncccntttcangganggcagn
ccttccaaattttattnctttttnnaccancaaatncangagngcttccnggggcataan

Image Files
Larval GFP

g1 (->Large)


CLOSE