Detailed Information [104661]
 

Strain Information
DGRC Number 104661
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP4295 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}NP4295 / CyO, P{w-=UAS-lacZ.UW14}UW14
Original Number 4295
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4295

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak (TU)
Larval GFP sg
Larval X-gal sg
Adult GFP leg, internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13725_0727
Flanking Sequence
gnangtttttttggnnaggantanctnnggttnatnnacccatttttttgggnctnncgg
naagncttcggctatcgacgggnaccaccttatnttatttcatcatgTTCGTAGCTAAAA
AAGAAACACGTCTGCACTCGCCGACGGGCTCTACGACGACGGGCTCGGAGAATGAGGTCC
CTCGGTTGTCTTTTGTTAGGCCTCATTGGTGGGCGAGTATTGCTCAGGTCGCTTGTGGCG
CCTAAGCCTTTCATGGTAGCGACTTGAGTACTAGNTTATTTCATCAAATACTTATTTCAT
AAAATCCTTGTGCAGGGTTGTGTTTCTCACATACCACTCGCAAGCAGTGACCAATTTCGT
AGCGCTATTCTGGATATCCTGGTTCTTATTGATTTGGCTGTCACAAGCTAAGCCCCAGAT
TTGGCACCCGTACCCGCATTTCTTCCAAATAAGAGCTATAATCATTTTTTAGTCACCTTA
TTTGATAGTGACAATTTACTGCGCGACCGGAGTAGCCAATAGTGTTTCGCCATCTTAGCA
CATATTCGTGTATTTAAGTCCGTAATATGTTTAGAAAATGTGAGTCTGCgatcgaagaat
acataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaaggg
caagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctggg
cataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagg
caactgtctttgacctttggtactactctcttccgatgatgatgtcgcacttattctatg
ctgtctcaatggtagaggcatatcagtctcactgagccannnnnnnnntngggggnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE