Detailed Information [104676]

Strain Information
DGRC Number 104676
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP4434 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP4434 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 90B6
Map Viewer
Related Genes CG14327 tRNA:V3b:90BC
Original Number 4434
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4434

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1526
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np16465_0727
Flanking Sequence
acgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacctta
tgttatttcatcatgAGTGGACCATTTAACATAAGTGGTgatcgaagaatacataagaga
gaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatcc
gacatgtcatcctctttcagaccaatcaaatccatgaagagcatcccctgggcataaaat
ccaacgggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgt
ctttgacctttgttactactctctttccgatgatgatgtcgcacttatttctatgctgtc
tcaatgttagaggcatatcagtctccactgagcatnttttttntgngggnnnnnnnttcn
nnnngnnannccnntnnnancnannnaanncnnnaanngnnnnccngggnntnaaanccn
acgggnntggnnnnnntnnnnnnnnnnnnnnncnnnnnaannnnnncnnnnnanngnnnt
tnnnccttnnnncnaccnnnntncnnnnnnnnnnnnnnnnntnntnnnnnnnnnnnnnan
ggnnnnngnnnnnnnnnnnnncncntganccatnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np57913_0309
Strand Minus
Insertion Point 13440936
Chromosome Band 3R
Flanking Sequence
gngnggngggnnngnnngnggnnggnnggnnngttttttggnnnggttttttngggcntn
aaccccagtctacgttagtggnagtctcttgccgacgggcaccccttatgttatttcatc
atgGGTCCACTTAAGGGTGGGGAGCGTCGACATCATATCAGCTACTGTCGCAAGATGTTT
CTATGTCCTTGTTTGTCCTTAGTCATGTCATCCTTTAGTCCCATAGCCCGTTTAATTGTG
AGGATCCNCNNNCNGNNGCNTAGGCCACTAGCNNATNATGAAAACTANAGCTNGAGNNAT
NANTACTCNNAANTAATAAAANNAGAAACTTTAAAAATAANTTCNCACTAATTAATATTA
TGAGTTAATTCAAACCCCACGGACATGCTAAGGGNNAANNANNANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE