Detailed Information [104770]
Strain Information
DGRC Number 104770
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP4745 / CyO
w*; P{w+mW.hs=GawB}NP4745 / CyO
Break points/Insertion Site 87A3
Map Viewer
Related Genes Hsp70Ab Hsp70Aa CG3281 S-element{}1293
Original Number 4745
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4745

NP line. Received from the National Institute of Genetics.

Balancer CyO; TM3 Sb Ser
Cluster id 1451
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression mixed pattern, cns+pns, muscle (SG)
Larval GFP sg, gut, tr
Larval X-gal sg, tr
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np32845_0907
Strand Plus
Insertion Point 7784106
Chromosome Band 3R
Flanking Sequence
cncttngcgtgcactgaatttatntgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCCCCCGNTATTNTNTATTCGTTTNGGGACTCTNNCTNTN
TGTACTATNGCTCTNTNACTNTGNCGCACAGTAAACGGCACACTATTCTCGTTGCTTCGA
GAGAGCGCGCCTCGAATGTTCGCGAANAGAGCGCCGGAGTATAAATAGAGGCGCTTCGTC
GACGGAGCGTCAATTCAATNCAAACAAGCAAAGNGAACACATNGCGAAGCGTAAGCTGAG
CAAACANACNAGCGNCANNTGAACAAGCTAANCNNTNTGNANNNAANNGNNTGNTTAANN
GAATCANGTNAATNNTTCCCACTTCCAAGTGATTTGAACTGATAACTGTGGCTACTGAAA
TGAACCATTACGTGTTATGAAAGTACAACGAGTAGAATTCTNANTGTGGTGTTGNGNGTC
NANNGNCTGCTNACCTGGCNCTTGGTGNGGGNCACACCCTCCNAGNTNAGAGCGCGGAAC
GCNANNNNNNNNACNCAAGAGTGNNCCNNCCTNGCTANACNCNCTNATTATCTGNGANTG
GNTGAAGAGCNNNTGNANCGTACTACCGNTTTTGGGGGGGGTGNGACATGGNNCANGGGC
AGCGTCCACCTCATCCAAAATGTACAAGGGAGCCGGAGAGAACTTAAGCATGGCCAGGAC
AAGAGACAGAGCCACCAAGGACTTCTGGCCACCAGAAAGTTCACCGAGACTCTTCTTTCA
TATGCCATTGAAGCCGACTTtaatctccaaaccggncagacagccattggtatggccggg
attgagtttcgcttcagcncccggnaaagagagctaagntcgagaatccttngananacc
gnnnccaagaacccatnttgntggggtccgtttnaggaaggcagccttcccctgnct

CLOSE