Detailed Information [104836]

Strain Information
DGRC Number 104836
Genotype with FlyBase Link P{w[+mW.hs]=GawB}cin[NP5070] y[*] w[*] / FM7c
Genotype P{w+mW.hs=GawB}cinNP5070 y* w* / FM7c
Break points/Insertion Site 1A1
Map Viewer
Related Genes EG:BACR37P7.9 cin EG:BACR37P7.2
Original Number 5070
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP5070

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 2
General Information NP_lines
Embryonic Expression PNS subset (?)
Larval GFP sh. unhatched only. PSP, gut, trachea. need retest.
Larval X-gal sh. Not in disc.
Adult GFP gut only
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43625_0912
Strand Minus
Insertion Point 13151
Chromosome Band X
Flanking Sequence
ncgtagcgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgCATGCAACCATTTTGCTTCTAGTTATCGATAATTCAGTAA
AGAACTCTGGAGTGGGAACACTGATTACAGAAACAGAAATATTAACCCCACAATGGGCAT
GTCATGTCGAGAAATAAATAAATATAAATTAATAAGCCACTACTTTTTAGCTTTATTTTC
AAAGTATATACGAAATCAATCCACAATTTAGAAGACAAGTTAGGACATGCTTAGTACCAT
CTGCCATTAATGCATATGTACATACATATATTGTAAATGTGGTTTCTTTGTAGTTATTAT
ATAGTTTATTTATTTACCATAAAAAGTACACAAACACGGGTATAAACTGGTCAACAGTAC
TCCTAGAACTCTTGGCGGGTTAAGGGTTAATTGGCTTGCTTCTCGGCCCTTCGTACGGTC
CTCCAAGGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgg
ggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatc
catgaagagcatccctgggcataaaatccaacgggaattgggggagttatcatgatgagc
tggccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatg
atgatgtcgcacttattctatgctgtctcaatggtagagnatatagncnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)


CLOSE