Detailed Information [104863]
 

Strain Information
DGRC Number 104863
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5130 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP5130 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D1 - 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 5130
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5130

NP line. Received from the National Institute of Genetics.

Also known as esg-Gal4, esg-GAL4, P{GAL4}NP5130, escargo Gal4, Esg-Gal4
Original Comments comment1:escargot
Balancer CyUW14
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression Not fathfully reproduce esg pattern. dorsal head (ea disc?) similar to esg. leg, wing, genital disc not apparent. tracheal tip cells in late bro.
Larval GFP VERY IMPORTANT. ESG TRAP (seq check). very similar to P127 (esg). tracheal node, DB fusion point, abdominal histoblast. leg disc (ring), genital disc, labial?.and wing +haltare disc.
Larval X-gal eye disc posterior to MF. weak in other discs. (s.g.)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2019-02-25
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np45285_0912
Flanking Sequence
GTCAAACGTGCACTGAATTTAAGTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACCA
CCTTATGTTATTTCATCATGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCC
ATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGA
CCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATC
ATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTC
TTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTC
CACTNGATNTTTTTTTTNGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np66073_0309
Strand Minus
Insertion Point 15311856
Chromosome Band 2L
Flanking Sequence
attttctgcgcacttattgcaagtctacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgGTTCCGCCGAGAGTATGCATGTTCATTCAGGTATATGCGTC
GACCAATCGCGACACTCGGCTAAACAGGTTTCGCCTTGTTTATGTAGAATTGCCTCACGT
GCCGAACTCGTACACTTGCACCAATCGAAGCCGCAAACGAAGCGATGCCGTTATATTTGC
TCTAGTGTGGGCCATATATTCAAATATGTTTACCTGTGTGCGTCGTGCTCTCCGCAGCTG
CTCTCTCTCGTCCTCTCTGCATTTGCATTCAATGCGCAATAAGGAGAGCTATGATCCTCT
AGCTNAGGCTNTAGGNCACTAGCGGATNATGGAACCTNTANCTTNGNANTNTGANTNCGN
NTAATTNATACCTGAGNTNATTAAACCCNCNGACNTGCTTANGGTNAANCNGAAANNCAN
ANNNCNTGGNCNNGNNCCCNNNNNNNNANNCTNNNNNNNNNNGCNNNNNNNNNNNCNNNN
NNNANNNNNNNNNNNNNNGNNTNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)
Larval GFP

g1 (->Large)

g2 (->Large)
Adult

a1 (->Large)

CLOSE