Detailed Information [104876]

Strain Information
DGRC Number 104876
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}l(2)35Bg[NP5152] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}l(2)35BgNP5152 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35B8
Map Viewer
Related Genes Su(H) l(2)35Bg yellow-c
Original Number 5152
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5152

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1192
General Information NP_lines
Lethality lethal
Embryonic Expression many tissues
Larval GFP sh. sg, trachea
Larval X-gal sh. Not in disc.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np45475_0912
Strand Minus
Insertion Point 15016897
Chromosome Band 2L
Flanking Sequence
nggggnnnaggnnngngttttngttttttttttttnngggantcacacngtngggtcata
nancccnttntttgggtgacttncggtaaagacttccggctatncgacgggnaccacctt
ttgttatttcatcatgGCTTGAACTTTTGAGATATTCTAGAAACACATCCACAATGGAGA
ACTTTAAGGGTCTACAAAAATCCCTATACATATGGACGGACAGCGCCGACTTGGACAAGC
GCGTGGAGCAACTAAAGGCGGCCACTGGCGGCGATGTGGCTTTGGAAAATGTGCACCGCC
TTTCGTTTTGTAAGTTGCGTGCGGTGCGGTGTGTGTGTGCTGTTTTTGACTAGCCAGTGA
GTCAGCAGATTAAAATCAGTGATGTTTATGCATTACAGCTTCCTATGCCAACTCCAGTTT
CGACCTGATTGTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattg
ttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatca
aatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatga
gctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgat
gatgatgtcgcacttattctatgntgtctcaatgttagaggcatatcagtctccactgag
catnnnnntnnntngggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn


CLOSE