Detailed Information [104879]

Strain Information
DGRC Number 104879
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5156 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP5156 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 46F1
Map Viewer
Related Genes CCS CG30011
Original Number 5156
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5156

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 648
General Information NP_lines
Embryonic Expression patchy
Larval GFP trachea, anal pad
Larval X-gal sh. Not in disc.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np45515_0912
Flanking Sequence
AACGTGCACTGAATTTAAGTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACCACCTT
ATGTTATTTCATCATGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTA
TTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAA
TCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGA
TGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCC
GATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACT
GAGCTCTTTTTTTTTNGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
NNATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaan

Library Name / Clone Name np / np66123_0309
Strand Plus
Insertion Point 5184680
Chromosome Band 2R
Flanking Sequence
gagggnggnntngtttgttnnttggnnnantcacacgggnntntnnancccgtnnanttg
ggggnggntgtctcctgccgacgggnaccaccttatgttatttcatcatgGTCTGGATAG
NGCGTGCCANGGAAAATTAGCCTTGCCTTTGTTTCANTTGCATTCCACAAAGACGCACGC
ACACACACACGTGCACAGAATGACCCTTACAGTGGGGCTTTGGTATTGGTATTTGTATTT
GCGGGTTNAACGCCACGCTCTTTTGGAGCGAGAGTGAGAGNGGGNNGAGAGAGAGAAACA
TAACGGGCTAGTGTATTTATTTTAATATTAGCTTTGTGACGTTCGCTCACCAAATCAGTA
TTTTTCGTACCATCGGCGTTAAAACACATGTTCGGCGATTTAGTGCGGGAGTGTAAACTA
ATCTGAGTAACAACAACAGCATCGTCGGCAAAGCAACAACAACGGCAGCAGAAAATTTTA
ACACGTTGACGCTTTTTCTAGTGTTTATAGCGAGCGGAAAAGCTTACTAAGCGCGTAACA
AGCGAGACCCCGAAATCTTTTTTCATCTCGGTCTTTTCGCCTTTGCGTCTTTGAGTGTGC
GTGCCAAAATTCAAATACGTCATCGACGCGCGCAGCCTTAAATCGAAAAGGAATGAAATA
ATTGATATACACAAATGCCAGCGAAAGATTGAATTCAATTGCAGGAGCAACAAATAGCCA
AACAAAATTGAGGAAAACAATTCCTTCAACCGCACAGNGACAACTTNAATTAATTAACTT
GGTATTGGGTAGNAGCAGNCcgcttnttgccattcaccggggaaacgcagccncacaaaa
aaacgngcaaaacagntgggactngaactganagtaacggnacgtnnngcaacaagngca
gnancagcagcagngcngngaaaatgcannaccacnncaacatnagcatnatnaacaaca
aacaaaccctttcantgntggaaaagagggggccntgnnnnggggnccnccan


CLOSE