Strain Information | |
---|---|
DGRC Number | 104884 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP5172 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}NP5172 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 50B6 |
Map Viewer | ![]() |
Related Genes | CG12464 fas |
Original Number | 5172 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP5172 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 736 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | patchy not in disc. CNS |
Larval GFP | dorsal epidermis in the thorax and in abdomen. wing and hal disc? Rare DV restricted pattern. |
Larval X-gal | VERY IMPORTANT. broad dots and stripes in wing discs. |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np45635_0912 |
Strand | Minus |
Insertion Point | 8681203 |
Chromosome Band | 2R |
Flanking Sequence | cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat gttatttcatcatgGACCNACCCTTGACACTCATTNAGNACCACCTANAGAGCTCTTATC GAGTCTGTCTTGCTCTGTCAACGATTGGCAAACCTGACATTGCGCCAGATGTGCCTAAAG AAAAAACACACCCGAAGTCATNAAACAAGTANCTATATATCATAGCTCGCTGATAATAAT AATGCGGCCTGATTAAAGGCTCGACACGAGAGATTTCCCGCCCACCCGCTGATAGAGGCT TAGTCCTTGGATATCCTGGGGAAATCCTGGGGGTGCGTTCCTTgatcgaagaatacataa gagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcc atccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaa atccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactg tctttgacctttggtactactctcttccgatgatgatgtcgcacttattctatgctgtct caatgttagaggcatatcagtctcctngntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nncccnnnnanggnnnnnnnnnnnaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnntnnnnnnnnnnnnnaannnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |