Detailed Information [104945]
 

Strain Information
DGRC Number 104945
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}heix[NP5301] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}heixNP5301 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35F6
Map Viewer
Related Genes BG:DS02740.8 Cyp303a1 heix
Original Number 5301
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5301

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1210
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression many epidermal spots
Larval GFP sg. anal pud. (s.g.)
Larval X-gal not in discs. (s.g.)
Adult GFP internal only
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49825_0912
Strand Minus
Insertion Point 16277826
Chromosome Band 2L
Flanking Sequence
tgaattaagtgntacttcggtaagcttcggctatcgacgggaccaccttatgttatttca
tcatgGCCGGAAGCAAAGACGCAGCCGGAAAAGGAGAGGCATATAAGAAGAACgatcgaa
gaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagga
agggcaagccatccgacatgtcatcctctttagaccaatcaaatccatgaagagcatccc
tgggcataaaatccaacgggaattgnggagttatcatgatgagctgnccagtcaatcgat
acngtcaactgntctttgacctttgntactncttctttttcgatgatgatggcccactta
ntctntgctggcttaatggtagangcatattagtctccactgaagccatctttttttngn
nnnnnnnnntnnnnnnnnnnnnnnnnnncnnannnnnnnnngnnnnnnnngnnnnnnngn
nncnnnnnnnnnnnncnnnnnncnannnnnnnnnnnnnngnnnnnnnnnnnnnnannnnn
nnnnnnnnnnnnnnnnnnnncnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnggnnnnnn
nnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE