Detailed Information [104952]

Strain Information
DGRC Number 104952
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG13624[NP5323] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG13624NP5323 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 96A9
Map Viewer
Related Genes CG13624 CG13625
Original Number 5323
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5323

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1625
General Information NP_lines
Embryonic Expression patchy, CNS, prob. PNS(ch?) (TU)
Larval GFP sg only
Larval X-gal posterior to MF in eye disc. (s.g.)
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38435_0907
Strand Plus
Insertion Point 20398755
Chromosome Band 3R
Flanking Sequence
gaactaagtgtnacttcggtaagcttcggctatcgacgggaccaccttatgttatttcat
catgATTGCGGCTGAAGGCGAAGGGCAGGCAAAGCAGCTGAAAAAAAAAGGAAAACCACC
GAAATCCCAATCCACAAATGCACAAACCAACACGACTGTGGTGTTTTTGTTGTGGTTAAG
AGAGTTTTATGCTAATTATTGGGGGCGGGGCAACAAACACACACCACTGGCGTCCCACTC
GATACANATATACAGTTGCTTACGCTTTGTTCGCTGNAACGAAAGCNGCAACAAAGCAAC
CAAAAGCAGAACCATTTACATACNCNCACACNCATTGATNCTTTNTTGNTTACAAAGCAA
AAATNTTANAATGCTTNTATTTAGCAGAAGATGGCCCTTACCTATTCTGGGTTTGAAGCC
CAAATGNGCGGGNCACCTTTNAACTTGATAATTACCANGGGTTTTTCCCCAGGTACACCG
GTTATTTCCGGGGGTTTTGNAACNAATTTTTTNGGAACCAACANCCAGGTCCCAGGGGTA
AANNAAAACTATTTACCCTTCNGTTTTGGTCCCGTTTTTTNACACAAGGTTTTCNTTGGC
CTGGCAACAATGTTNGAAGGGGGCCCTTNNTTTGGGNGGAAAGGGGNGGGCCTTTCNAAA
ANAAAATTTTGGAAAAAAAATTTAAAANTTTTTTTTCCCCTTTTCCCCTTTTTTTTTTTC
CCAAAATTTTNCNNTAAAACNAANAAAAACCNGNCCCNGGGGNGGGGGCTTTTTTTTTTT
TTTAAAGGGGGGGGGCCCCCatttttttttttggccaacnnnaaaaaaaaaaagngttgg
gaaaattannaatttccccccccctttttttttgggggccttttccttnnngggccccct
tttttttttttttttnaaaaaaacctttttttnnccnngnggttnttttnncccccccnc
ccccnanttn


CLOSE