Detailed Information [104973]

Strain Information
DGRC Number 104973
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5360 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP5360 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 95F3
Map Viewer
Related Genes mask CG5677
Original Number 5360
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5360

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1621
General Information NP_lines
Embryonic Expression subset of muscles
Larval GFP sg, fb
Larval X-gal not in discs. (s.g.)
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50375_0912
Strand Minus
Insertion Point 20047003
Chromosome Band 3R
Flanking Sequence
TGAAAACGTGCACTGAATNTAAGTGTATACTTNGGTAAGGCTTCGGCTATCGACGGGACC
GACTTATGTTATTTAATCATGGGTNGGACCATACTGCGGCTCGCGATATAAATTCACATC
GATATTTCTCCCTTCACTTTTGTTTCCGGCAGGGNGATATTTTTGAATAGTCTGGCTGTG
GTCCCATTAGTTTTGAATTTGTTTACTAACTTCTCTCTTGTTATATATGAGAGAGTTCAT
AATATGGAGATATTTTTAATCTTCTTTAAGAATCTTGCAAATTAGAAATTGTTTGATTTT
GATTTTGCGGTTACATACACGACTTTGCCATGTTTCGGTTTTTAATATAAAACAAATTTT
CTCTGCTGCAAGTGTGCCCATGTAGGAAAAATTGTGCAATGCTTAAATTATTAATTATTA
TTCGAATAGTTTTTGAAATGATGACCTGATATTTACGATTACGACTATAGAAATGATTTA
ACGCGAAATATTTTGATTTTTAACCATCAAAAGGAAATCGGGTTATTCGCGTTGTTCTTT
CGGGCCGAACCGGGGAAAGTCATCGATAGTNTCGCGTTCATCCGATTATCGTCCCAGCTC
TAATTTTTTTCCAAACTAACAACACGACGTGTCATTNGCCGGAATCGCAGGAATAAANCG
ATATTAAAATGCCCACCGGTGTTAACCCCGAGGAAACGCCNCGGGGGCATACACGCTTGA
GCGTNNTAGCTTGCCTCACCTTTAGCTGNTTACTGTCCACCGNTTTTCTTGNCTACCGNN
CCGATGCAACATNACACGGNcagagngctggngaaaaagncccggattccggggcgnccn
ggagagcnccantgggnctncngnaccttgntcgaaaanccnaaaaaaaanccnccccaa
aacn


CLOSE