Detailed Information [104989]

Strain Information
DGRC Number 104989
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Atpalpha[NP5397] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}AtpαNP5397 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 93A4; -; 93B2
Map Viewer
Related Genes CG31191 Atpalpha
Original Number 5397
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5397

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1567
General Information NP_lines
Lethality lethal
Embryonic Expression weak
Larval GFP CNS
Larval X-gal not in discs. (s.g.)
Adult GFP hinhe, ventral thorax and others.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50725_0912
Strand Plus
Insertion Point 16783359
Chromosome Band 3R
Flanking Sequence
ANGNNCTGANTAAAGNGNTTNCTTAGGNATAGNTTNGCTATCGACGGGACCGCCTTATGT
TATTTANTCATGGTTCTATCCGAGAATCGAGAAAGCTTAACGCACTCGCGGCGCGCCGAA
AAGTTTCAGTCGAACGTCTANTCCGAACTGGGAAGGTCCAACTGTGACAGCAGCAGCTAT
CTNGTCTCTTTGTCGGGGNGGTACAGTACAGCTCTGCTCCCCTGCCGCCCGNCCGCCCCC
TCGGCGCTGGTGTGNGCCCGCTGCTCTGCTTACACAATAACTGTGCATCGATTGAGTCCA
GCTCCAGCGAGAAGAGAAGCAGCCCAGGACTAACTCTCGTTCGACATAAGAATAAAAGGA
TATTACGTTAGCGTACAGCAGTCGTGTGTGATCNAAGAATACATAAGAGAGAACCGTCTC
CAAAGAACCCATTATTGNTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCAT
NCTNTTCAGACCAATCAAATNCATGAAGAGCATCCCTGNGCATAAAATCCAACGGAATTG
TGGGAGTTATCATGANGAGCTGNCGANTCAATCGATACAGNCAACTGTCTNTGANCTTTG
GTACTACTCTNTGGCGATGATGATGTCGCACTTATTCTATGCTGNCTCAATGTTAGAGGC
ATATCANTCTCCNGNTNNNNNNNNNNNNNNNNNGGNNNNNNTTTTTTTTTTTNGGGGGCC
NNNNNNNNTTNNNNNNGGGNCCNTNNNTTTNAAANTTNNGNNCCNCCTTNTTTNNGAAAA
NANNNGGNANNTAATNTNTTttngnnntcnntgnnanagggaaacacctcnnncnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnn


CLOSE