Detailed Information [104991]
 

Strain Information
DGRC Number 104991
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}alpha-Man-IIb[NP5401] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}α-Man-IIbNP5401 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 89A5
Map Viewer
Related Genes alpha-Man-IIb CG9593
Original Number 5401
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5401

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1504
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression segmental repeats. dorsal-edge. anal pud. ps.
Larval GFP fb
Larval X-gal not in discs. (s.g.)
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47015_0912
Flanking Sequence
GGGGGGGGNAGGGGGGGNGGGGGNGGGGGGGGGTCTCNCTGGGGGGCCGCTCCCCCCCCC
NGGNNNAAAGGCCCAAACTCTGGGGGGCCCGNNGGGGGGGGGGGGGGGGGGGGGGGGGGG
GGGNNGGGTGGGGGGGGNCNGGNCNNNGGNGGGGGGGGGNGGGGGGGGGGGGCGGNGCNC
GGGCGGNCNGGGGGNGGGGGGGGGGGGGGGGGGGGNGGGGCGGGGGGGNGGGGGGGGGGG
GGGGGGGGGGGGGCGNGNGGGGCCCGGGGGGCNNNNNGGGNGGGGGGGCGNGNGNGGNNG
GGGGGCGGGGGGGGGGGGNGCGGGGGGNGGGGGGGGNGGGGGCGGGGGGGGGGGGGGNGG
GNCGGGGGANGNGGNGNNGNNGGGGCGGNGGNGCGGCCNGCNGGGNGGGGCNCNGNNCCC
CGGGGGCGGGCGGGNNCNGNGGGNGNGGGNCNGGGGGGGGGNGGGGGGGGGGNGGGGGNC
NGGNNNCNGGCNNNGNGCGNTGGGGNNCCGCCNCGNCGTGGGGGCCGCGTNTCNNCCCGN
TCGCGGGGGGGCCCCGGGCCNGCGGGGCCGGGCGGGGNCGNGGGGGNTGGGGNGGGGNGG
GNGGGGGGGCNGGCCNGGCCGGGGGGNGGGNGTGCGGTGGGCGGGNGGGNGGGGGCCGGG
GGGGTGGTGGGAGNGGGGCGCGGCGGCCGTCGCCGNGCGCGNGGGGGCNGCGGGAGGGCN
CCGCNNGNCCCNCCCCCCNCCGCGGNGCGGCTCCGCCGGNNGGCCCCCCCCCCCCCCCCC
NGGNGCCCCCCCCCCGGGGGccccccccggggccgggggcnngccccccccnggcccccc
ccgnnggngnggggcgnccgngcccccnnnngcccngggnngggggggggggnaaggaaa
gnnccnggtncggtttttaaggtgggngggnnncctcccggtgtaggnnnnggngggtgg
gccctccncgnccnctcggttgggggcggttnnntttggtggggncgcggcngccgncct
ttncccttccccgggtnngggggnaganccccccnnnnncncncgggtgggngggggggc
gcatcctcctccggcgcgggcnccccttttntttcngcngggcggagnnnnggnnggccc
acccccagaaaanttcctttgggggtgtgtgggggtaaatnttcccttncccgnccttcc
ccnccgtgnggccnnncccttccccccccnngccccncttgnnnncctttccgnnccccn
gggggaannncgncccntncnccccccctggtttttagggggggggggggccgnnnnncc
ttnncccccccgnnncttttttccccaacngnnnnnccccccgnnnncnggtaggccccc
ncccccccncccccttttgnggcnnnnnngccnnnggggnnttgggggnngggggggggg
gggcccccccgnnnnnnnnnnncggnnggt

Library Name / Clone Name np / np66673_0309
Strand Plus
Insertion Point 11629973
Chromosome Band 3R
Flanking Sequence
ttttnctgcgcacttattgcaagncatacgttaagtggatgtctcttgccgacgggacca
ccttatgttatttcatcatgNGNAGNACCAGCTCANTGAAAGGNGAGTATAACGCTTTCT
TGCGTATGGNCATATTAACGAATCNTNTGTTCTNTCCAGTATCNACNAACACATGTATGC
CCNTTNATGCTCTGGGGTGGNTGCCCNTGGNCCNNNGCGCCCNGAANGATNCTNTATACT
AGAGACTTGGATAAATTAAACCAATAAAGCACATATCCTATGTGCCGTTATTGGCCGACG
ACTGTAATTGNTTTTGCGCGGGTGTAAAGTGCACGTGTGTGTGTGTGTCAAGGATTACGG
CAAAATTGTAACTGTTTGTCGTGGGCATGTGTGTGTGCGTGGGAGTTTGATGGAAACCGT
AAAGNTATAAACAAAAGCCGAGTTCCACGAAAGGTGAGAAATCGAAAGCGCTGATTCGCG
GCACTTGCCGCAATCAATATAGAAACCACCCTCCAAATAGCGTCTGTTTACTATGTCAAA
AAAAAAGAGGATGGAGAAAACCGGATTTCTCAGCCTCGAACAAAGGAAATTGGGTGTTTT
TCTGGGCTCGGGGATCCTCTAGCTGNNNNTTNGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE