Detailed Information [105033]
 

Strain Information
DGRC Number 105033
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5478 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
y* w*; P{w+mW.hs=GawB}NP5478 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 78C9
Map Viewer
Related Genes BcDNA:GH11973 McClintock{}1079
Original Number 5478
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5478

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2020
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP tr, epi
Larval X-gal outside of wing pouch. epi. mt. ring gland. (s.g.)
Adult GFP part of notum. haltare, lateral
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47645_0912
Flanking Sequence
NNAGAGAGAAAAAAAAAAAAAAANGGTTTTANAAAAAAAAAAGTTTTNTNTNNANAAAAA
NAAAAAAAAAANTTTNNTTAAGAAAAAANNNNNNAAAAANNTNNAAANNTNATAAANNNN
ANNAANCNNNNTTTATTANNATNNNNATNNNTNANANNNAAAANNNNANNNNNNNNNNNN
ANAANNTNNAAANNNNNANNNANNNNANNNNNNNNNNNNANNNNNNNANNNNNNNNNNNA
NNNNNNAANAANAANNAANNNNANNANNNNNANNTNTAANNTAANNANANNNNAAAAAAN
TNNNANAAATNNNNNNNNNNNNTNNNNAANNNAAANNNTNNNTTNNNNNANNNNNTNNNA
NNAAAATNANNNAANAGAGNNAAAATTAAANAATNNTANANANATATAANAANANAAAAA
ANTNNAAANANANATAAAANATAANAATAATAANAAAANNNANTNNNTNNNNATNNAAAN
NNNNNNAAAAAANNATNANANAAAANAANANNAAAAAAANAAAAAANANATNAAANNAAA
NAAANTAAAAAANATTATAAAATAANAAAAAAAAAAAAANTANTTANAAAATNNANNANT
NNATAANATAATATAAANAAAATATAAAAANATNTTAAANNAANTTATAAAATAAAANAA
AAAAGNTNTAANANAANNNATTTANAAATATAATAANNAAAATANAAAAANGTAAATTAN
ANAANANANAAATANTAANAAANANNNNNTATATNNTTATNAGAAAGAGAAAATTNNTAA
TATAATAANAAAAAAAAAGAaanaaaaaaanaaaaaaaaaaaaaaannngaaantaaaan
atnnaaaaanaantaaaanataaaaaaaataaaaaaaaataannatnaaaaaaagggana
aaatataaannataaaagaaaanaataanaattatattatatnaaagcgaagaaanaana
annaaaattaaanaaaaataannnantntananatataatnnttnantnanataatnnnn
nnntnnaaaaaannaaaaaaaaataaanaaanaaataaannaaataanaaaaagaaaaaa
aaaaatnntataananaaaaananaaaganaanatntaaaaanatagattaaaaaaagan
aatananagatataaaaanaaaanaaagnacgagnnataananaaanananaaagaaana
aanataaaaaanttaaaaaaaanaaaatnataaatattatgntatanaaaaaaatagnna
taantnaaanaataanaaaaaaanaagaanntagaaaaaantaaatttnaagnagngaga
aaanaagaaaaaaanaaaaaaaaaaaagnaaaaaaaangttaagaanaaaantaaaanaa
aanaatnanagataanagaanaaaanatannantnaaaaaaaaannatantaaaaattaa
anatgntantaaananaaaaaaaanaananaaaaaaaaaaaaataaaaaaaaan

Library Name / Clone Name np / np67063_0309
Strand Minus
Insertion Point 21299783
Chromosome Band 3L
Flanking Sequence
nttttacttcgcacttattgcaagtnttacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgCGACTGGCTATCGCGAAAGCAAACTCAAAGCTCGCTGCT
CAGCTGCCGCTGCCGGCTTGCCAGCGTTGGTGTTGTGATGCTGTTGTCGACAAGAGAAGA
AGAGGAAGAAGAGAAAGAGAGAGAGAGCGATAGAGAGGTACACTGGAAAAACACTTCCAT
ATGGGAGGTGGTCTTAAAGTGGCCATAAATAATAATGCTTACAAGTAAAAAGACAGACGG
ATTATATAACTTTCTAGTCATAGTTTATGCTACATTTTATTTAGTTCAGATTCCGTTACC
AGCAGACATTTCATTAAAAATATTTTGAATCAAAAAAATGGGATAATATATATATATATA
TACATAAATAAACATTATTTCATTAAATCCTTCATAATTAATGGCATATGCAGATGATTT
ATAAAAAAAAGGGATATAATTCCCATAGATTCCATTGATACTCCCCGCAAATTTTTGGTG
TTCAAAGAGAGCTTCAAGCTCTAAAGCTGAAACTGAAAGAGTACAAGTGTGCTCTTTTGN
GAAATTGCCGGTTTGGCTCCACATGTTTTGNTTACAACGGCTCCCACTCTAGCAACATGT
TGGGGAGCGAANNTTTCGCTNTTTTTCGCGCTTTTATTCNTTTNGAAGNGNGATCCTCCN
CCAGNGCCTTTGGNNNNNNNNNNNNNNNNNNCNNNNTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)
Adult

a1 (->Large)

a2 (->Large)

CLOSE