Detailed Information [105059]
 

Strain Information
DGRC Number 105059
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP5935 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP5935 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 26F3
Map Viewer
Related Genes CG11098 CG31635
Original Number 5935
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5935

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1075
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression Weak .
Larval GFP epi stripe, CNS, other
Larval X-gal checked
Adult GFP weak lab, prob, abd.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47955_0912
Strand Minus
Insertion Point 6641312
Chromosome Band 2L
Flanking Sequence
ttnatctttngtgcactgccatttaattgtatacttcggtaagcttcggctatcgacggg
accaccttatgttatttcatcatgGTTTCGCCAGTTTCGCGGCTCCATCGGAGGAAATTT
TGTAAACCCAGTAACTAAATTTGAGTGCGAAGTAAGCCTCTTCACTTTGAATAATCCTAA
TGCTCGGTTTCGGAACGCTCTGAGTGCTGCAGTGGGTGGCAAACGACAGGACTATGTGCG
TGTGTGTGGCTGGAAAACTTCAGCAGTGACCTTGAAAATTGAAGTTTGTTTTTTTTTTCC
TTTATGCACTTCACCCGAAANTGTAACGCNCAAAATTNGGGCTAGCTTTTTAGAAAAAAG
TCGCCGGTGTCCAACAAAGTNCTCAGTGAAAGCTGGCGTATTGGATTCCAATTTATTATT
ACCTTACGAAGTGTACGGAAAAAGGTTTCCTCTGACATCATATTGGGGAATTCAGAGAGC
GATTAAGAGAGCAGCGGATAACTTTGGNGNGATATGCCCGATAATGTATCCTTAAAACCA
ATAACCTTGNGCGGGTTATAATTAAGATGCTAATTTAAGNGAAAAATCCGGGGAGCATGT
GTACAGAAACTTTATTGGTTTGATGTTGGATGTTGCTTGCGATTTAANGGGANTGTGAAC
CAAAAGGGTNCCTNAAAAGAGCCCACGGGGGGGGGGTTGCCCGNTCGAGAATTCCTTNGG
AGAGAACCGNCNCCAANAACCCATTNTTGTTNGGGNCCCGTTTCAGGAAGGCAAGCCCTT
CGANATGTTATCCTTTTTAGaccaatcaaatccatgaagagctncctgggcatnaaatcc
accggaatgggggngttttatgaagagctgccgggtnaatcgatccagcaacnggcttgg
accttggnaccaccctnttncgaggaggaggcccncttntntngctggctcaangtagag
gcatttagctccncccnnnntttttttttnnnnnnn

CLOSE