Detailed Information [105069]

Strain Information
DGRC Number 105069
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}kirre[NP6008] / FM7c
Genotype y* w* P{w+mW.hs=GawB}kirreNP6008 / FM7c
Break points/Insertion Site 3C5
Map Viewer
Related Genes rst pogo{}30
Original Number 6008
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6008

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 95
General Information NP_lines
Embryonic Expression weak
Larval GFP sg
Larval X-gal sg, midgut
Adult GFP internal. verified (091998)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42085_0912
Strand Minus
Insertion Point 2766819
Chromosome Band X
Flanking Sequence
tncanacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGTCTGGCATCTGGAATCGGGATTCAGGCAACTCCATCCGG
AGCCGAGACAGTGATGCAGTCTTGACAGATAAACAGGAAGTCGTCGTCCTGCCCAACACT
TCAGCCTGTGTGTCGAGTGGTTGTATGGGTGGGTGGGTATATTTTGGGGNGGGTTGNNNN
NNCNNNNANNNNCNNNGANNGGNNNNNCNTNCNNNNTGGNNNNCGNGNNTCNNNNNTNNN
NNNNNTNANNNNNANNNNNNCNCCNNNNNNNNNNNNNNNNNNNNNNTNNTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTNNNNnnnnnnnnnctnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnntnnnnnnnnnncc
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nntnnntnnnnnnnnnnnnnccntnnnnnnnnnnnnnncntnnnnnnnnnnnnnnnnnnn
nnnnctnnnnccncnnnnnnnnnnncnnntnnnnnnnnnnnnnnnnnnccnnnnnntnnn
nntnnnnnnnnnnnnnnccnnnnnnntnnnnntnntnnnccntnnttnnnnttnncnnnn
nnncnnnttnnnnnnnnnnnnnnnccnnnnnnnnnnnnnnnnnnnnnnttnnntntttnn
nnntnnnttnttnnnnnnnntnncnnnnnnttnntncnnnttnncntnatc


CLOSE