Detailed Information [105071]

Strain Information
DGRC Number 105071
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}CG3600[NP6011] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}CG3600NP6011 w* / FM7c
Break points/Insertion Site 2B17
Map Viewer
Related Genes CG32802 Stalker2{}22
Original Number 6011
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6011

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 50
General Information NP_lines
Embryonic Expression random(?) epidermal cells, muscle subset.
Larval GFP epi, tr
Larval X-gal sg, hindgut, all trachea, ubiquitous epi
Adult GFP ubiquitous
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42115_0912
Strand Plus
Insertion Point 1720548
Chromosome Band X
Flanking Sequence
ntntaaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGGCTACACTGTCATTGCCGTTTGCCGAAGTCGATGTCGA
AGTCGGCCGTTGAGTAGCCGATGTGAGAGCGCGAGAGCTGGAGANCTACAGTGGTAGCTC
CACAGAGCGGATTTCTCCACCAGTCGCATTGCCTGATTATTATCTTTATTAATGTCTATT
TAATCCTATGCTATCAAGAGTATGCGATAATATACAAGTACTTGTCTTTGTTGGACATTG
TAACGAGCGAGCACTGTACACGATAACTACTAAAAAAAAACGAATAAAAACCGAAATAGT
GCCTTGCATTTTCGTTATCGAAATAGTCAGAAATTGGGTAAAGCACAAGGGGAGCTGAAG
GGGGCCCAAAAAGAGATGGCAAACGAGCGGACTGCGCAACTTTTTTATACCCAAAGTCAT
TCACCTTTCGCTCTCTCAAATGTTCTGCTATGGGGCTTTTTTATTTACGATTACTTCCAC
CACCACGAACGAACTCCGCTTAAAAGACTTCTCTCAATTCTCTCTTTTCAACTGCGCCGC
CGACTTAACGCCCACACACACACACAAACCCGAAAACGTTGGCGGATGGAGAGAGANAAA
GAGCGAGAATGGAGACAACAATAGAAAACGGAAGCGNCAAATTATTTTTTTGATTTTTTG
ATGGGCAATGAAATATATTGACAGCAGTTTGTCTGGNGTGTGGGANAGCANNAAAGGGGG
GGGGNNNNNNNTTTTTACCTttctctngggcaaatanaaaaaggaattacntgcanggca
attagaanacanccngctgggaactgnttnacatgnaanaaaaacatcgntnggggggtt
ttntcgaaggaaattntttgggggatcgaaaanacataaanaanacccgncncaaaaacc
cnnttggnggggggnn


CLOSE