Detailed Information [105148]

Strain Information
DGRC Number 105148
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6210 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP6210 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 21F3
Map Viewer
Related Genes CG5156 CG5397
Original Number 6210
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6210

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 988
General Information NP_lines
Lethality lethal
Embryonic Expression CNS, epidermis (TU), many other scattered cells (sh).
Larval GFP sg, tr
Larval X-gal sg, midgut
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np44425_0912
Strand Plus
Insertion Point 1235679
Chromosome Band 2L
Flanking Sequence
ttnngtgcactgactttaantgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatCAGTAAGTAATACTTACTCAATCTCATAAATTCAAACCAATTAT
TTTGAAATGTAACCAGAGCTGACTAAGTGCATTGGATTTGTTCGAAGAAAGTTAAAGTTG
TAAGTTTACCATTCCCTGGTTCACCATTTAAGCAGGACTCATCTGTGATTTCTTTCCTCA
TCTCCCATCCTTGCCTAATTCAATCGGCTGTGGCAAATTAAAGTTCCATTTCTCTTTTGG
CAAAGGCGTCAAACCCTTGCCAAATCAAAGGAAAAATCCTTCTTATCGGGACAACCCTTG
GCCCAGGGTCAAAGTTCGACTGAATCCCCGACCACGCTTAGCATATGCGCATAAATCACT
GGGCAAAAAGGGGAGCGCGGACCCAGGAAGAGCAGACAGAAAGCCACCCGCTGCAGGACA
ATAAAATGGCTAAACGCTACAATGACAATTCAAGCATGTAAATGAAAGGCGGACTAGGAA
TGGAACAGCGAAGGGGAGGTCCTGGCACAGGACAAAGGGGCATGAGGCTGGGGGAATCGA
AGACGGCAAANGACTTTGGTAGATGCCCGCGCGCAAATGAAATTAAAGACGAGCAAACAG
GTTNCGGTCAGACAATCAGGGAGCGTAAAAANGACGAAGGACACTGGCCTGCATTGGGCC
GAACGCACACCAGCCCCCTTTTCGCTTTAATCAATTCCTGGTGGGGCACGCCCTTAGTCC
CTTAGTTTTTTGGNTTCTGActgacnaaaaatttgncntttgggggatttcttgnctgca
acncaaanatggattcgngctnggncgggaanccccctttgatggctgnccnccccttgt
ttggcc


CLOSE