Detailed Information [105156]

Strain Information
DGRC Number 105156
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6227 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP6227 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 30B8
Map Viewer
Related Genes CG13112 Gdi
Original Number 6227
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6227

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1132
General Information NP_lines
Embryonic Expression midgut (TU)
Larval GFP weak epi
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np44555_0912
Strand Minus
Insertion Point 9487694
Chromosome Band 2L
Flanking Sequence
cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgAATCACCAGTAAAACTTTGCAGAGGCTTCGGGATAATGTGACCAGA
CTCGCTAACTGTGCTAACAGCTGTAAGAGGAATGCCCCTAGTTTCTATCGTGTCTTCGAT
AATAAATGTACGAAAATGTTGGGTTTTCTTGAAATTATTACATACATTGAAAAGTCTAAT
TGCTTATATTGTATTCTCTGTAAAATAAAAAGTAATGAACGAATGCGTGAGATATGATAT
AAATAGAGATATCCAGTAACTTAAAACTCGATAGGTAAACAGCGTTCAAATAATGTTTAC
CCATATTTTGCTGAATATCTTTTTATATTTTATATGAGCgatcgaagaatacataagaga
gaaccgtcgccaaagaacccattattgttgggggcccgtttcagggaggggaagcccatc
cgacatgtcattcctctttcagaccaatcaaatccatgaaagagcatccctggggcatna
aatccaacgggaattgngggagttatcatgatgagctggccgagtcaatcgatacagtca
actgtctttgaccttttgttactactctcttccgatgatgatgtcgcacttattctatgc
tgtctcaatgttagaggcatatcagctccgctnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE