Detailed Information [105201]

Strain Information
DGRC Number 105201
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP6328 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w* P{w+mW.hs=GawB}NP6328 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D2
Map Viewer
Related Genes BG:DS04862.2 lace
Original Number 6328
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6328

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1200
General Information NP_lines
Embryonic Expression sg (TU)
Larval GFP sg
Larval X-gal sg, DT, midgut, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np69435_0810
Strand Minus
Insertion Point 15490964
Chromosome Band 2L
Flanking Sequence
gnntcttnggtnngcttcggctatcgacgggaccaccttatgttatttcatcatgAGCCA
GACGCTTGCGGCAATTACCACAGCCAAGTAGACAAAAAAAAAGGTTTNTNGGNCTCGANG
GGCCAGNTGGCCTANGNTNTTAAATNGGGGGCCCAAAANGCAATTNCNAAATATTANCGC
NNGCNTTTNCNTAATTNTTAAATNGGGTTNTCAANCATAANCCGATTNGGTNTTTATGTT
TCANTTNGGCTGGCNCNCTTGCNGNTTAATTGGTTTTTNNCGAAACAAAANGAAAATCGC
AGCCCGCAAACAGAAATTTCAATTCCTATTAAATCNTAAATTTAATTTCAAATTTTTTAC
NCCGAAATCAAATCAAATTCATTGGTAAGGNGTAAGGGGAAAAAAGCNCCGAATTTAATT
TGCAAATTCAAATTGGNTGGGGAATTGGCTAAATAATTTTGGGCCCTGGGAAGNGCGTAA
ATTGGAAAATTTNTTCCATAGAAATTTTAATTGGCNTTTGGGAAACCCTTATGCCAAGGT
CTTGAATGGAAATTGNAATAAAAATNTTTTTTAAACTTGGGATTTGAAAATCCNAAAGAN
GGAACCCCNGCNCCCAANAACCCCTTNTTGNTNGGGGGNCCCNTTTNAGGGANGGGCAAG
CCTTCCCCNATGGTTTTCCTTTTTAGACCCAANNAAAATCTTGGAGGGGCTTCCTGGGCA
TAAAAACCACGGGGATTGGGGGGGNTNTTTATGGGGGGNTGCCGGGNNAATCGAACNGGG
NNACNGGGTTTGGCCTTTGGacctccttttttccggnggggggccccttttttttggtgg
tcaaggtngggnantngccgncnnnnnnntttnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE