Detailed Information [105202]

Strain Information
DGRC Number 105202
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6330
Genotype y* w*; P{w+mW.hs=GawB}NP6330
Break points/Insertion Site 30B5
Map Viewer
Related Genes CG3769 numb
Original Number 6330
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6330

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1128
General Information NP_lines
Embryonic Expression CNS (TU) ? very weak (sh)
Larval GFP sg
Larval X-gal sg, midgut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np48235_0912
Strand Minus
Insertion Point 9429690
Chromosome Band 2L
Flanking Sequence
atttttcgtgcactgantttaantgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGCTTGGAGCACAAGCTCCTCAAAGGCGCGAGCGAGCTGGG
GATATAGATAGAGAGAGAGAGCACAGATTCACCCTTTATAACGGTACATTTCAAGACATG
TGATTGACAGTTCGCCAGCCTGCATCCCTGACATGGCGTTGCCACTCTGTGGAATTGTGC
TACCCTTAATTTAAAGTTTACTGGTTAATTGCAAAGTTGCTATTTTAAAATCGTTATAGG
CTAATTTTCGCAGTTAGGTATTTTTTCTCAATTTTATTTATTCTGCATTCACCTAGCATA
TATCTTCAAAATTGCTATTGCTCCTGCTCGAAGATTGCCATGTCAACTCAGTGTCCTCGA
AATCCACTATATCTCCCAGACGCACAGGTCCCTTGACCGTCCGCATGAATTGCATCTTGG
GTTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgggggtc
cgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatg
aagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccga
gtcaatcgatacagtcaactgtctttgacctttggtactactctcttccgatgatgatgt
cgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagntnnttnt
ttttngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnn


CLOSE