Detailed Information [105221]

Strain Information
DGRC Number 105221
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}BEAF-32[NP6377] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}BEAF-32NP6377 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 51C2
Map Viewer
Related Genes BEAF-32 CG12856 CR30478
Original Number 6377
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6377

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 764
General Information NP_lines
Lethality lethal
Embryonic Expression general
Larval GFP sg
Larval X-gal sg, midgut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np48565_0912
Strand Minus
Insertion Point 9835607
Chromosome Band 2R
Flanking Sequence
TTNNNTGNTCTTCGGTAGCTTCGGCTATCGACGGGACCCCTTATGTTATTTATCATGGCC
TTGGTAATCCGCACGGTTTTGTCTGCAATGCAAAGGATGGAAGCGATGGTTAATACGATA
CATATTGGTACAGCTACCGGATAATAACAAAAATATCATAACCCAGAGATGGGCGCCGGC
GATAGTTTCCCGCCGACCCAAGGGGTCGATAGCCCGCCATACGAACTTCGCTGGAATTAC
CTTTCTTTGATGATTGGGATCGAAGGAATACATAAAGAGAGAACCGTCGCCAAAGAACCC
ATTATTTGGTGGGGTCCGTTTTCAGGAAGGGCAAGCCNTCCGACATGTCATTCTTTTTAG
ACCAATCAAATTCATGAAGAGCATTCCTGGGCATTAAATCCAACGGAATTGNGGAGTTAT
TATGAAGAGCTGGCCAGTCAATCGATACAGGCAACTGGCTTTGANCCTTGGTACTACCTC
TNTTCCGAGANGNNGNTCNCACTTAATTCTTGCTGNCTCAATGGTAGNNGCATATTANNC
TTCACTGAAGCCATTNATTTTGGGNNNNNNNNNNCNTNTTCCNTCCCCCTTGNCNNNCTN
NNNGCNNNCCNTNCCNNCGCCNNNGAGGNNGNNTCNNNNGTNNACANTNCNNNNNNNTTN
NCCNNNCNNTNNTNNCCCCCNNNCNNCNTTNNNNNTNNTTNCNNNNNNNNNCNNNNNNNC
CNCNCCNCNCNNNCCNCNNNNNNNNCNTTNCNCNNCNNNNTCCNNNNNNNNNNCCNNNNN
NNNNNNNNNNNNCCCNNNNNnnnncnnnnnccctcntncttccnnnccnnnntnncccnt
tnctttnncttcncccncnccn


CLOSE