Detailed Information [105231]
 

Strain Information
DGRC Number 105231
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6502 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6502 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 77E3
Map Viewer
Related Genes CG13253 kni
Original Number 6502
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6502

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2007
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression Possible expression in tracheal terminal cells of gustric branch. Interesting mesoderm in A3-6, amg in stg 8. gonadal mesoderm?!. But not expressed in gonad itself.
Larval GFP terminal cells in tr.
Larval X-gal peripodeal memb. of the wing disc,
Adult GFP all bristles. stronger in macro. joint of leg, mouth. wing hinge mergin.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46015_0912
Flanking Sequence
GAAAAAAGGGCGGGCGGGGNGNGGGNGGTNTTTGGGGANTTTTTCCTGGGGGGGGGCGGN
CNNNNNNTNGGGCNGNCCNNGGGGGGGGGNNCGNNNGNCGGGGGGNGGCNGGGCGNNCNA
GGNGCCGNGCCNNGNCCTNTCNGGGCCTGCGGGTNCNCCCCGGNGNCGGGGCGCNNNGGN
NCGNCGGGNCGGGGGCGGGCNGCNTGNCGCGGCNGGNGGNCNNTCGNACCNCGGGTGNGN
GNNCCNGNGNCCCGNGGCNTGGNGGGNCCGGGCGGNCCCGCGGGGGGGGGNGGGGCGGGG
GGCCCNNGGCGGTNGCNCCCGNCGGGTTCGGGGGTTGGNGGCCCCCGNNTNTGGCCCNGC
GCCNCCGGGGCGCCNGGNCCGCNCNGGCGNGNNGNCCNCCCCCTCNCTGTNCCGNCNGCG
NCNGCGCNNCCCCGTGTNAGGGNGGGNGGGGCGGGGGGNGCGCGGGGNNNNGANTTTNNG
GGTNCTGNGCAGTGAGAAGGNCGNGCTGANCCCGNNGTGTNNGNCCCCGCAGGNGNNGNC
NCATGTGNGAAGACGANAGGGCGGNCCTAANACNCNNGGCGGGGGGANAGGGGGNNANGG
GCAGGNACGGNNNCGGGGAAGCAGNGAGNGGNNGNCNGACGCGNNANCNCCNCCGTTCNA
NGAGGACANGACGNNGGATTNNCCGCNNGTCCCGTNNCCACNCGACCANGCAGANTAACA
CACAAAANACAACAGNACAACCAACNTTAACANAANGGGGCCACCCANGGGGGGGACCCC
CNNCCCCCCCACAACCCGGGgngggggnaaagggnnccccccggggnncnnnnnagggag
gggctnananggnaaaaaaaaggacatnnaagggttgngtttnnccnntttnaaaaaaaa
aagggaatttgntcgnntcnncgggacgnctaggnnccncccncgggcngcnccnccaaa
ttttgnnnggntgggngncgnnnnnnnntcnngggnngnntaaaggggggccnntcttng
ngggggccttanntnannggggancnnggnggggaaanccccnccccccccttttttntg
tnntggtgnnnnattttgcccnnnntnacccnnttggggcaaggacccccacgggggggg
ggggggggttnttgagggggggggncccccngggtnttaaaanagggacccnaaaaaaaa
aanacccccncacnaannactnaaaaaannnngcgnccntcannaggaggtgtggggggg
gncnccannngnnnnnaaanaanan

Library Name / Clone Name np / np66263_0309
Strand Plus
Insertion Point 20614425
Chromosome Band 3L
Flanking Sequence
antcttnngcgcacttatccgcaagtttacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgGGCGGAGCCGTTTTGGCTGCTCGAAATCGAAATGGTTGG
AGGCCAATTCGCTTGGGGTTTTCTTTTCAAAGTCCGCCGGTTTTTGGGTACATTTAGAGT
TGCCTGTATGCCTAACACCTAGTTTGATTTTCAAAACCTTTTTCCGCGGGAAATATTCCC
ACTTTCTGTGTGATTCACAAACTGATTCTCAAGATTTCATGAAATGTGTTAAAATTTGCA
TAACCGCGACTTGGCAATAAATTGAAACGCTTTAATTAGAAGTTAATCAATAAGAGATCC
TCTAGCTAGNGGCTTTGGCCACTAGTGGATCTGGATCCTCTAGCTAGAGNCTTTGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e10 (->Large)

e11 (->Large)

e12 (->Large)

e13 (->Large)

e14 (->Large)

e15 (->Large)

e16 (->Large)

e17 (->Large)

e2 (->Large)

e3 (->Large)

e4 (->Large)

e5 (->Large)

e6 (->Large)

e7 (->Large)

e8 (->Large)

e9 (->Large)

CLOSE