Detailed Information [105233]

Strain Information
DGRC Number 105233
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}heph[NP6506] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}hephNP6506 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 100C6
Map Viewer
Related Genes CG2003 heph
Original Number 6506
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6506

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:100F1-F4
Balancer TM6UW23-1
Cluster id 1708
General Information NP_lines
Lethality lethal
Embryonic Expression PNS(ch+others) (TU)
Larval GFP sg, psp
Larval X-gal wing pouch, circle (PNS?) in tarsus and ch organ, sg, CNS
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46055_0912
Flanking Sequence
GTGNGGGGGGGGGGCGGGGGGGNNNTTGGGGGGAAATNTTTNNTNTNAAAANCTTTNNTN
GTNTACNCTATACNNNAGNNNAAGATTTNAGANNNNGNATNTTTTNGNNCAANTAANANN
NGGGGNGANNNNGNGNGNNANCNGAGNGNNGCNNGTNCGNNAGCNAGNGAGNNGCGTNGC
NNGNNNGGGNGGAGGGGCGGGAGGNGANGNTNNAGNGNGTGANGANGNNTNNCGGNAGGC
GGATNGGCNNANANGGAGAGNCGNNGCNTANNNANNTGTAANTNAGCTNGACNGNANCGA
TNCNCNNAGTGANNNTGGGAGAANNAANNCNTCGGNGGNGGGACGTAGTCNNGCAGAAGN
GNGGGNAGTNGGGTAACAGNGGGTTTNNGCAGNNCCNCTGCGAGTNANGANTGNTNNTNG
GGTTNNANNAGNNNNGGGANNNNCGATANNNGGNGGGTNNNGNGNNAGGGNGTANATNGA
NTGGNGCAANNNCANCNNNNNNAGNGTNANAAAGGNNACAAAGCNTTCNTANTGNNGAGG
CANNTTAGCNGNATATNTNNNCNGNANGANTNNTGAANNNNGTNNGTNNNCACNCCNNNN
NNNTCNCNCNNGNNAANTANGTATNGANGNNNNNGNAGGNAGGNNNCNAAGGANNGAAAA
NNCNGTTAAGNGNGNNNNGNANAATNCGCGNGNATNANNNGGNNNCANNGGANCGTGATG
CGNNNGNCNNNTNNNTANNCNGNAGNTGGTNCGNANTGGCGNTGANNGCGNGANCGNNNG
NNNNANNANCGNANCNCNANtgnnngtgagtagngnnnnnncgatgncgcgnnancggcn
nnagtggngtgagggcngcgggtnnanngnncccgnncngnnggngngggaagangcnga
gatcncanancnngttaancnnggatccacgttatntgtnnncgacancanannnnnnta
tngcngnangcngancgangcgtganggcnganngacgnnatnnggntgnagagnnagat
atcgnngaangagtgacgnnngnnntnganacctgnaggacnnnntgcgnagatgnggaa
gtcgggagngnnngngtagttaagnnacgttagngacganatntanccaacancnacntn
cgnancgagnnngttggcannaaagnatgtnnaggantnanngaagtangcantgtntnt
anaagagatngangagagnagngcngganagatncnangatacatntnntagnnagcgag
gangngagnncgcggnntagnnggggnagcnagccngnggtgnnnangngtnnagngtgt
ngtncnnnncacnnggncncngcctnngacgnanggagtcagtnagttnagcggcngcng
ntgantgngnnngtacggngngttaaataagcgncgngntcganngaggcacncagtcgg
cnnccgtcgngnngnncntgtnnncncatacgntntnnggngccganntatannngccca
tgtcgncncngggatgngnttntttngannncncnnnnttannctgtgcagngncntana
tgtcnnncgntggtnggntcaccgcnancgnatnngngtntgncccngctcnantggnaa
gnggnttnatanancgnttgnggcaagntgngngagnttttcngncctgtncntcncgta
ntnttttt

Library Name / Clone Name np / np66303_0309
Strand Minus
Insertion Point 27751407
Chromosome Band 3R
Flanking Sequence
cttttactgcgcacttattgcaagncatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgGCTCCGATTCTGTCCATAAAACCTTATGGCTTGCGTTCC
AATAGGCCGCACACAAACAGCCGTAGTCAGCATAGACGGCATCCTCTTGGCCACTTGTCG
CTGCTGCTGCTGGCGTACTAAGTACGCATTCATATAATTCCCGCAGTTTATTTTTATTGT
TGTAATTACACGTTGGCGGAGTGCTAGGGAGACAGCGATCCTCTNNCTANCGGCNTAGGC
CACTAGTGGATCTGGATCCTCTANCTAGAGGCTNTGAGTTCANACNCCCANACAATGCTN
AGGGTGAANNCACCACNNANCNNGNTTGNNGNNNNNNNNNAANNNNAANNNCNNNNNNNN
NNNTNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)

d5 (->Large)
Embryo

e1 (->Large)


CLOSE